Pebmulti bsd vector

Full-length hnRNPA1 and hnRNPU mRNAs were cloned into the pEBMulti-Bsd vector (Fujifilm Wako Pure Chemical, Osaka, Japan). For full-length HNRNPA1, cDNA was amplified by PCR using the following primer set: 5′-GGATCCGCCGTCATGTCTAAGTCAGAGTCT-3′ (forward) and 5′-GCGGCCGCTTAAAATCTTCTGCCACTGCCATA-3′ (reverse). A full-length hnRNPA1 was amplified using the following primer set; 5′-GGATCCCTCACCATGAGTTCCTCGCCTGTT-3′ (forward) and 5′-GCGGCCGCTCAATAATATCCTTGGTGATAATG-3′ (reverse). The amplified products were subcloned using BamHI and NotI restriction sites (these sequences are underlined). HCT116 cells were transfected with these constructs for 48 h at a final concentration of 1.5 μg/mL using Lipofectamine 2000 reagent (Thermo Fisher Scientific).

FLAG-tagged PITX1 expression plasmids were as described previously [29 (link)]. pFLAG-ZCCHC10 was constructed by amplification of ZCCHC10 cDNA from IMR90 cDNA by PCR using KOD plus DNA polymerase (TOYOBO, Osaka, Japan) and the following primer sequences; forward primer: 5'- GAAGATCTTATGGCGACTCCCATGCATCGGCTAA, reverse primer: 5'- GGGGTACCCTATTTCTTTTTCTTCTTCTTTGGT. Sequences were inserted into the BglⅡ/Acc65I (TOYOBO) digested FLAG-tagged vector pCMV-FLAG4 (Sigma). pCMV-FLAG4 was used as a control.
Non-tagged PITX1 or ZCCHC10 expression vector was inserted into the pCMV6-XL5 vector (Origene, Rockville, MD, USA) or pEBMulti-Bsd vector (Wako, Tokyo, Japan). PITX1 ΔHD1, ΔHD2, ΔOAR and ZCCHC10 ΔCCHC expression plasmids were established using a mutagenesis kit (TOYOBO), according to the manufacturer's instructions. The following primer sequences were used; PITX1 ΔHD1 forward primer: 5'-CGCGAGCGTAACCAGCAGCTGGAC, reverse primer: 5'-GCTCATGTCGGGGTAGCGGTTCCT, PITX1 ΔHD2 forward primer: 5'- ATGAGGGAGGAGATCGCCGTGTGG, reverse primer: 5'- CTGCTTCTTCTTCTTGGCTGGGTC, PITX1 ΔOAR forward primer: 5'- TTTGGCTACGGCGGCCTGCAGGGC, reverse primer: 5'- GTAGACGCTGTAGGGCGAGGCGGG, ZCCHC10 ΔCCHC forward primer: 5'- ACAGGAAAAAGAAAATACCTACAT, reverse primer: 5'- TCTTACATGTTGCTTATTTGCTTC.

The 3p21.3-loxP targeting vector was constructed as an X3.2 vector, which contains additional restriction enzyme sites (SpeI, BamHI, PacI, and SacI) of the AgeI site in the X3.1 vector (Kononenko et al. 2013 (link)), which contains a loxP site and a 3′ HPRT site. X3.2 vector constructed the annealing oligo 5′-CCGGTACTAGTCGGGATCCCCTTAATTAAGGGGAGCTCA-3′ and 5′-CCGGTGAGCTCCCCTTAATTAAGGGGATCCCGACTAGTA-3′ into subcloned into AgeI sites of the X3.1 vector. For the addition of the sgRNA target site in X3.2, the annealing oligo 5′-TAACCAAACACGTACGCGTACGATGCTAGCT-3′ and 5′-AGCATCGTACGCGTACGTGTTTGGTTAAT-3′ subcloned into PacI/SacI sites of the X3.2 vector (X3.3). For the addition of the marker gene, the blasticidin S-resistant gene was amplified using PCR with the pEBmulti-Bsd vector (Wako) as a template and primers (5′-GGAAGATCTCCAGCAGGCAGAAGTATGCAAAGCA-3′ and 5′-GGACTAGTCAAGTTTCGAGGTCGAGTGTCAGTC-3′), digested with BglII/SpeI (NEB, Hertfordshire, UK), and cloned into the X3.3 vector (3p21.3-loxP targeting vector).