Lmp retroviral vector

Resting splenic B cells were isolated using CD43-microbeads, stained with 5 μM CFSE and cultured for 72 h in vitro with LPS (50 μg/ml) for CSR to IgG3 and IgG2b, LPS + IL-4 (5 ng/ml) for CSR to IgG1 and IgE and LPS + IFN-γ (100 ng/ml) for CSR to IgG2a. CSR was assayed by flow cytometry as described [4 (link)]. Primary B cells were transduced with retroviruses expressing Parp3^Flag, Flag alone or AID^Flag-HA and a GFP reporter as previously described [53 (link)]. For knockdown experiments, the hairpin sequence for AID (5’-ACCAGTCGCCATTATAATGCAA-3’) was cloned into the LMP retroviral vector (Open Biosystems), transductions were performed as previously described [49 (link)].

Two shRNAmirs targeting FRA1 (shFRA1 A: 5′ CCTGGTGCCAAGCATCAACA 3′ and shFRA1 B: 5′ TGGACAGTATCCCACATCCAAC 3′) were designed using the RNAi Codex database [49] (link) and cloned into the LMP retroviral vector (Open Biosystems). The LMP vector containing a non-silencing shRNA (shControl) was a gift from Dr Gretchen Poortinga. The pBABE-puro-FLAG-FRA1 construct was generated by PCR-mediated fusion of a FLAG epitope to the N-terminus of FRA1. The following antibodies were used in this study: anti-FRA1 (R-20; Santa Cruz Biotechnology), anti-FLAG M2 (Sigma-Aldrich), anti-14-3-3 (Santa Cruz Biotechnology), anti-vimentin (Cell Signalling Technology), anti-E-Cadherin (BD Transduction Laboratories), anti-ZO-1 (BD Transduction Laboratories), anti-14-3-3 (BD Transduction Laboratories) and anti-β-catenin (BD Transduction Laboratories).