Esophageal cancer cell lines KYSE510 and KYSE30 were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). KYSE510 and KYSE30 cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 Medium (Invitrogen, Shanghai, China) supplied with 10% fetal bovine serum (Invitrogen, Shanghai, China), 100 U/mL penicillin and streptomycin (Invitrogen), at 37°C with 5% CO2. The small interfering RNAs for DUXAP8 and negative control (Invitrogen, Carlsbad, CA) were transfected into KYSE510 and KYSE30 cells using RNAiMAX (Invitrogen) based on the manufacturer's instructions. 48 hours after transfection, the KYSE510 and KYSE30 cells were harvested for RNA extraction. The siRNA sequences of DUXAP8 are 5′‐AAGATAAAGGTGGTTTCCACAAGAA‐3′ and 5′‐ CAGCATACTTCAAATTCACAGCAAA‐3′.
Kyse30
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
The KYSE30 is a laboratory instrument designed for performing various analytical tasks. It is a versatile piece of equipment that can be utilized in a range of research and testing applications. The core function of the KYSE30 is to facilitate accurate and reliable data collection and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (13 mentions)
Eca 109, by Thermo Fisher Scientific (10 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (10 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (9 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (8 mentions)
Kyse 150, by Thermo Fisher Scientific (7 mentions)
Ec9706, by Thermo Fisher Scientific (5 mentions)
Kyse510, by Thermo Fisher Scientific (4 mentions)
Streptomycin, by Thermo Fisher Scientific (4 mentions)
Kyse30, by National Collection of Authenticated Cell Cultures (3 mentions)
Het 1a, by American Type Culture Collection (3 mentions)
Kyse 450, by Thermo Fisher Scientific (3 mentions)
Dmem medium, by Thermo Fisher Scientific (3 mentions)
Kyse410, by Thermo Fisher Scientific (3 mentions)
Kyse150, by National Collection of Authenticated Cell Cultures (3 mentions)
Kyse180, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
1640 medium, by Thermo Fisher Scientific (2 mentions)
Kyse 150, by American Type Culture Collection (2 mentions)
Kyse30, by American Type Culture Collection (2 mentions)
24 protocols using kyse30
1
Esophageal Cancer Cell Line Knockdown Protocol
2
ESCC Cell Culture and α-Amanitin Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ESCC cell lines KYSE30 and Eca-109 were acquired from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai, China). KYSE30 and Eca-109 cells were cultured in RPMI 1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Invitrogen) in a humidified incubator containing 5% CO2 at 37°C. Where indicated, the ESCC cells were treated with 50 μM α-amanitin (Sigma-Aldrich, Saint Louis, MO, USA) for the indicated time to inhibit RNA polymerase II-mediated transcription.
3
Regulation of ESCC Cell Lines by KCNQ1OT1 and miR-133b
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human ESCC cell lines (KYSE150, KYSE30, KYSE450, EC9706, and EC109 cells) and human esophageal epithelial cells (Het-1A) were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Thermo Fisher Scientific, Shanghai, China) containing 10% fetal bovine serum (FBS, Sciencell Research, Carlsbad, CA, USA) at 37°C in 5% CO2.
pcDNA empty vector (normal control, NC), pcDNA-KCNQ1OT1 (KCNQ1OT1), scrambled siRNA (normal control, si-NC), small interfering RNAs against KCNQ1OT1 (si-KCNQ1OT1#1 and si-KCNQ1OT1#2), miRNA control (mimics NC), miR-133b mimics, an inhibitor control (inhibitor NC), and miR-133b inhibitors were obtained from GenePharma Co., Ltd. (Shanghai, China). The KYSE30 and KYSE150 cells were transfected using LipofectamineTM 2000 (Invitrogen, Carlsbad, CA, USA). Quantitative real-time polymerase chain reaction (qRT-PCR) was used to measure the transfection efficiency after 24h of transfection.
pcDNA empty vector (normal control, NC), pcDNA-KCNQ1OT1 (KCNQ1OT1), scrambled siRNA (normal control, si-NC), small interfering RNAs against KCNQ1OT1 (si-KCNQ1OT1#1 and si-KCNQ1OT1#2), miRNA control (mimics NC), miR-133b mimics, an inhibitor control (inhibitor NC), and miR-133b inhibitors were obtained from GenePharma Co., Ltd. (Shanghai, China). The KYSE30 and KYSE150 cells were transfected using LipofectamineTM 2000 (Invitrogen, Carlsbad, CA, USA). Quantitative real-time polymerase chain reaction (qRT-PCR) was used to measure the transfection efficiency after 24h of transfection.
4
Esophageal Squamous Cell Carcinoma Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The normal esophageal epithelial cell line (NE3), originally developed at Hong Kong University, was obtained from Professor Li Fu (Department of Pharmacology, Shenzhen University). Other human ESCC cell lines, including Eca-109 (RRID: CVCL_6898), KYSE-30 (RRID: CVCL_1351), KYSE-70 (RRID: CVCL_1356), KYSE-180 (RRID: CVCL_1349), KYSE-450 (RRID: CVCL_1353), and TE1 (RRID: CVCL_1759) were purchased from the Cobioer Biosciences Co., Nanjing, China. NE3, Eca-109, KYSE30, KYSE70, KYSE180, KYSE450, and TE1 cells were maintained in 10% FCS-RPMI-1640 medium (Invitrogen, Shanghai, China). NE3 cells were cultured in EpiCM 4101 medium (ScienCell, USA). The cells were cultured in humidified atmosphere of 5% CO2 at 37°C. All cell lines were authenticated by matching the short-tandem repeat (STR) DNA profiles of the cell to the corresponding standard STR in the database of ATCC (the American Type Culture Collection) and DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen). All cells were routinely tested and found negative for mycoplasma.
5
Lentiviral overexpression and knockdown in ESCC cell lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were seeded into 24-well plates, the cell density was increased to 30%, lentiviral infection (MOI = 3) was carried out, and puromycin was used to screen stable cell lines for overexpression and knockdown. Construction, sequencing, packaging, concentration, and purification were performed on the lentiviral plasmid containing the target gene. Virus titer determination was entrusted to Shanghai Hanheng Company. METTL3-OE (NM_019852.5) and IFIT2-OE (NM_001547.5). The IFIT2 gene was silenced using small interfering RNAs (siRNAs), all of which were produced by GenePharma. By using Lipofectamine 2000, plasmids containing the transgene and a packaging plasmid were cotransfected into KYSE510 and KYSE30 cells (Invitrogen, USA). The sh-RNA and siRNA sequences are listed in Supplementary Table S2 .
6
Establishment of Normal Esophageal Epithelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary cultures of normal esophageal epithelial cells (NEEC) were established from fresh specimens of the adjacent noncancerous esophageal tissue, which is over 5 cm from the cancerous tissue, according to previous report [38 (link)]. The ESCC cell lines, purchased from Bogoo Co. (Shanghai, China), including EC18, KYSE30, KYSE140, KYSE180, KYSE410, KYSE510, KYSE 520, 108Ca, TE-1, ECa109, EC18 and HKESC1 were grown in DMEM medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Invitrogen) and 100 μg/ml penicillin, and 100 μg/ml streptomycin (Invitrogen) at 37°C in a humidified atmosphere containing 5% CO2.
7
Cell Line Cultivation and Maintenance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human Embryonic Kidney (HEK) 293 T and ESCC KYSE-30 cell lines were purchased from the Pasteur Institute, Tehran, Iran. HEK293T and KYSE-30 Cells were, respectively, maintained in the RPMI-1640 (Invitrogen, Carlsbad, CA) and the DMEM (Dulbecco's modified Eagle's medium) high glucose (Gibco, Carlsbad, CA) mediums. The ESCC YM-1 cell line was kindly provided by Dr. J. Asadi (Golestan University of Medical Sciences, Gorgan, Iran) and grown in DMEM/F12 medium (Gibco) [28 (link)]. All media were supplemented with 10% FBS and 1% penicillin/streptomycin (Invitrogen). Cells were grown at 37 °C in a humidified 5% CO2 incubator.
8
Transfection of miR-186 in ESCC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two ESCC cell lines Eca109 and Kyse30 were purchased from the Cell Bank of the Chinese Academy of Medical Science. Both cell lines were cultured in RPMI 1640 medium (HyClone, USA) supplemented with 10% fetal bovine serum (HyClone) and 1% penicillin/streptomycin (Invitrogen, USA) at 37 °C under 5% CO 2 and saturated moisture. Het-1a, a SV40 large T-antigen-transfected normal esophageal epithelial cell line was purchased from ATCC (USA) and cultured in BEGM BulletKit Medium (Lonza, USA) at 37 °C under 5% CO 2 and saturated moisture. The sample cells were collected and counted by trypan blue exclusion using a hemocytometer. miR-186 mimics or scramble (GenePharma, China) was transfected transiently into ESCC cell lines (Eca109 and Kyse30) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. The transfected amount of miR-186 mimics and scramble was 10 pmol per 1 × 10 3 cells.
9
Establishment of Normal Esophageal Epithelial Cell Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary cultures of normal esophageal epithelial cells (NEECs) were established from fresh specimens of the adjacent non-cancerous esophageal tissue, which is over 5 cm from the cancerous tissue, according to the previous report.28 (link) The NEECs were grown at 37°C and 5% CO2 in keratinocyte serum-free medium, with 40 μg/mL bovine pituitary extract, 1.0 ng/mL EGF, 100 U/mL penicillin, and 100 μg/mL streptomycin. The esophageal cancer cell lines EC18, ECA109, and HKESC1 were kindly provided by Professors Tsao SW, Srivastava G (The University of Hong Kong). ESCC cell lines KYSE30, KYSE140, KYSE180, KYSE410, KYSE510, and KYSE520 were obtained from Deutsche Sammlung von Mikroorganismen und Zellkulturen, the German Resource Centre for Biological Material.29 (link) These cell lines were grown in DMEM (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% FBS (HyClone, Logan, UT, USA). All cell lines were authenticated by short tandem repeat (STR) fingerprinting at Medicine Lab of Forensic Medicine Department of Sun Yat-Sen University (Guangzhou, China).
10
Cell Lines and Culture Conditions for ESCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells and the human ESCC cell line KYSE150 were obtained from the Cell Bank of Chinese Academy of Sciences (Shanghai, P. R. China). The human ESCC cell lines KYSE30 and KYSE410 were obtained from the China Centre for Type Culture Collection (Wuhan, P. R. China). All the cells were verified using short tandem repeats (STRs). All experiments were performed with mycoplasma-free cells. HEK293T and KYSE30 cells were maintained in DMEM (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Waltham, MA, USA). KYSE150 and KYSE410 cells were cultured in RPMI-1640 medium (Thermo Fisher Scientific) supplemented with 10% FBS. Cells were incubated at 37°C in a 5% CO2 atmosphere. The recombinant human WNT2 protein was purchased from Mulder Company (Hangzhou, P. R. China). All cells were cultured in the biosafety level 2 laboratory.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!