5-Pregnen-3β-ol-20-one-16α-carbonitrile (#P0543) was purchased from Sigma-Aldrich (St. Louis, MO). Lipopolysaccharide (E. coli, #tlrl-pslta) was purchased from InvivoGen (San Diego, CA). The RNeasy Mini Kit (#74104) was obtained from Qiagen (Valencia, CA). A 96-well PCR plate, Roche PCR Master Mix (Roche Diagnostics), TaqMan® primer and probes for Cyp3a11 (FP: GGATGAGATCGATGAGGCTCTG, RP: CAGGTATTCCATCTCCATCACAGT) and cyclophilin (FP: GGCCGATGACGAGCCC, RP: TGTCTTTGGAACTTTGTCTGCA) were purchased from Sigma-Genosys (Houston, TX). A Mouse WG-6 v2.0 expression BeadChip Kit was obtained from Illumina (San Diego, CA). TaqMan® Gene Expression assays with primers and probes for mouse Elk1 (#Mm00468233_g1), Mef2 (#Mm01340842_m1), Nrf2 (#Mm00477784_m1), Pea3 (#Mm00476696_m1), Stat1 (#Mm01257286_m1), and Mycmax (#Mm00487804_m1) were obtained from Thermo Fisher Scientific (#4331182, Waltham, MA). The primers for the epigenetic markers Ezh2, DNMT1, DNMT3a, LSD1 and RunX3 were a kind gift from Dr. Moorthy from the Baylor College of Medicine, Houston, TX.
Stat1
Manufactured by Thermo Fisher Scientific
Sourced in United States
STAT1 is a versatile lab equipment product manufactured by Thermo Fisher Scientific. It is designed to perform a core function of monitoring and analyzing biological samples. The device specifications and capabilities are based on established scientific principles, without interpretation or extrapolation on intended use.
Automatically generated - may contain errors
Lab products found in correlation
Cfx96 real time system, by Bio-Rad (2 mentions)
Taqman reverse transcription reagent, by Thermo Fisher Scientific (2 mentions)
Rneasy isolation kit, by Qiagen (2 mentions)
Gapdh, by Thermo Fisher Scientific (2 mentions)
Mousewg 6 v2.0 expression beadchip kit, by Illumina (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
5 pregnen 3β ol 20 one 16α carbonitrile, by Merck Group (1 mentions)
Dulbecco s modified eagle s medium dmem, by ScienCell (1 mentions)
Secondary antibody conjugated to horseradish peroxidase, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Foetal bovine serum (fbs), by Merck Group (1 mentions)
Rapigest sf surfactant, by Waters Corporation (1 mentions)
Sequencing grade trypsin, by Promega (1 mentions)
Peroxynitrite, by Cayman Chemical (1 mentions)
Trizol method, by Thermo Fisher Scientific (1 mentions)
Stat3, by Thermo Fisher Scientific (1 mentions)
Hif1a, by Thermo Fisher Scientific (1 mentions)
Cd274, by Thermo Fisher Scientific (1 mentions)
Pparg, by Thermo Fisher Scientific (1 mentions)
9 protocols using stat1
1
Quantification of Transcription Factors
2
Aflatoxin B1 Cytotoxicity Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The AFB1 used in the study was purchased from Sigma-Aldrich, USA (cat no A6636) and dissolved in dimethyl sulfoxide (DMSO) to a stock concentration of 3200 μM. The AFB1 stock solution was divided into aliquots, wrapped in aluminium foil and stored frozen at −20 °C until used. The AFB1 stock solution was diluted to the desired concentration in normal growth medium when necessary. The foetal bovine serum (FBS) was purchased from Sigma-Aldrich, USA. Dulbecco’s Modified Eagles Medium (DMEM) (high glucose, L-glutamine, sodium pyruvate and 25 mM HEPES) was purchased from Science Cell. Minimum essential medium (MEM) non-essential amino acids was purchased from Sigma Aldrich, USA while penicillin-streptomycin was purchased from Gibco by Invitrogen, UK. Lipofectamine 2000 was purchased from Gibco by Life Technologies, UK (cat no 11668-019). The human recombinant interferon-alpha 2 (rIFN-α2) was purchased from PBL interferon source (cat no 11115-1). The stock solution of the human recombinant interferon-alpha 2 was diluted to working concentration using phosphate buffered saline containing 0.1% bovine serum albumen as a diluent. The STAT1 (cat no PA5-34504) and GAPDH (cat no QE 212271) primary antibodies were purchased from Thermo Scientific, USA. The secondary antibody conjugated to horse-radish peroxidase (cat no 31430) was purchased from Thermo Scientific, USA.
3
STAT1 Nitration and Trypsin Digestion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
10 µg of STAT1 (purchased from Life Technologies; cat. no. PHF0011) was placed in MOPS buffer ((3-(N-morpholino)propanesulfonic acid)) at pH 8.0 and was nitrated using peroxynitrite (Cayman Chemical, Ann Arbor, MI) at 150 molar excess. 5 mM of 1,4-dithiothreitol was added to the solution to prevent additional oxidation. The buffer was exchanged via dialysis against 50 mM ammonium bicarbonate pH 8.0 at 4 °C. 500 ng of sequencing grade trypsin (Promega, Madison, WI; cat. no. V5111) was added to the mixture in addition to 0.1% Rapigest™ SF surfactant (Waters Milford, MA) in 50 mM ammonium bicarconate. The Rapigest™ detergent was allowed to digest the pure STAT1 protein for various periods of time from 4 hours to 24 hours. After the digestion step was complete, 30% formic acid was added to the mixture to deactivate the Rapigest™ SF surfactant by placing it at 37 ° C for 1 hour followed by incubation at 4 °C for 1 hour. Afterwards, the samples were spun in a microcentrifuge at 14,000 rpm at 4 °C for 15 minutes. The deactivated Rapigest™ SF surfactant forms an upper layer, allowing the collection of the peptide containing fluid from below taking care not to collect any pellet that had formed at the bottom of the eppendorf tube.
4
Splenic B Cell Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by Trizol method (Invitrogen) from 1×106 splenic B cells. After Nanodrop, 500ng RNA was subjected to first-strand cDNA synthesis for qRT-PCR (Origene). Five nanograms of total cDNA/RNA were used per reaction with TaqMan Fast Universal PCR Master Mix. The qRT-PCR reactions were performed on a 7900 HT Fast RealTime instrument. The primers and probes for mouse Aicda (Assay ID: Mm00507777_g1 and Mm01184115_m1), Ifnb1 (Assay ID: Mm00439552_s1), Irf1 (Assay ID: Mm01288580_m1), Irf5 (Assay ID: Mm00496477_m1), Irf7 (Assay ID: Mm00516793_g1), Irf9 (Assay ID: Mm00492679_m1), Stat1 (Assay ID: Mm00439531_m1), Stat3 (Assay ID: Mm01219775_m1) and Tlr7 (Assay ID: Mm00446590_m1) were purchased from Taqman Gene expression Assays (Life Technologies).
5
Gene Expression Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were washed using cold PBS, and RNA was isolated from the cells using an RNeasy Isolation kit (Qiagen, Germantown, Maryland, USA). Total complementary DNA (cDNA) was synthesized using TaqMan reverse transcription reagents (Applied Biosystems, Foster City, California, USA). YB-1 and other gene expression levels were measured using quantitative real-time polymerase chain reaction (qRT-PCR) on a CFX96 Real-Time system (Bio-Rad Laboratories, Hercules, California, USA) and normalized by glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Probes information is as follows: YB-1/YBX-1 (Hs00358903_g1), SUB1 (Hs00743451_s1), tryptophanyl-tRNA synthetase (WARS) (Hs00188259_m1), HnRNPH1 (Hs03044422_g1), CALM1 (Hs00300085_s1), MYL12B (Hs00853081_g1), PDCD6 (Hs00918238_m1), TPI1 (Hs03806547_s1), PGAM1 (Hs01652468_g1), PPIA (Hs04194521_s1), IMMT (Hs00986184_mH), LAP3 (Hs00429769_m1), CAPG (Hs00156249_m1), ACTG1 (Hs03044422_g1), STAT1 (Hs01014002_m1), MX1 (Hs00182073-ml), and GAPDH (Hs99999905_m1) (Applied Biosystems).
6
Profiling Gene Expression in Immune Cells
7
Quantitative Real-Time PCR for Gene Expression
8
Western Blot and Immunohistochemistry Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole cell extracts were lysed with lysis buffer (10 mM Tris [pH 8.0], 1% NP-40, 2 mM EDTA, 150 mM, 0.1 mM Na3VO4 and protease inhibitors [Roche]), resolved by SDS-PAGE and transferred to polyvinyliden fluoride membranes. Primary antibodies included: anti-TRIM14 (Proteintech), FLAG M2 affinity gel, Protein G-agarose beads, β-actin (Sigma), AIF (Invitrogen), p62, HAX1 (Genetex), phosphor-STAT1 (Cell Signaling), STAT1 (Invitrogen). After blocking, membranes were incubated with relevant antibodies and probed with corresponding HRP-conjugated secondary antibodies (Cell Signaling). All films were developed with ECL-Plus reagents (GE healthcare, Piscataway, NJ).
Formalin-fixed paraffin-embedded tissues were cut at 4-μm thickness and dried in a 60 °C oven overnight. Immunohistochemistry was performed using the peroxidase anti-peroxidase technique following a microwave antigen retrieval procedure. Ki67 and cleaved caspase-3 antibodies were used at 1:500 dilution following pepsin digestion. Whole slides were scanned using the Aperio Scanscope XT (Vista, CA). Percentage of cells with positive Ki67 or cleaved caspase-3 staining were independently blind scored (TW and JH).
Formalin-fixed paraffin-embedded tissues were cut at 4-μm thickness and dried in a 60 °C oven overnight. Immunohistochemistry was performed using the peroxidase anti-peroxidase technique following a microwave antigen retrieval procedure. Ki67 and cleaved caspase-3 antibodies were used at 1:500 dilution following pepsin digestion. Whole slides were scanned using the Aperio Scanscope XT (Vista, CA). Percentage of cells with positive Ki67 or cleaved caspase-3 staining were independently blind scored (TW and JH).
9
STAT1 Overexpression and miR-150 Modulation in THP-1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
STAT1 overexpression vector was obtained by cloning the sequences of STAT1 (Shanghai GenePharma Co., Ltd.) into pcDNA3.1 (Invitrogen; Thermo Fisher Scientific, Inc.) and termed pcDNA3.1-STAT1 (STAT1). Before transfection, THP-1 cells (4x105 cells per well) were seeded into 12-well plate. After incubation for 24 h, 0.2 µg of STAT1 overexpression vector (STAT1) and the control pcDNA were transfected into THP-1 cells using 0.5 µl of Lipofectamine 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Furthermore, the oligonucleotide sequences were as follows: miR-150 mimic (5'-UCUCCCAACCCUUGUACCAGUG-3') and negative control (miR-NC: 5'-GCCUCCGUACCGAUCCUACUUA-3'); miR-150 inhibitor (5'-CACUGGUACAAGGGUUGGGAGA-3') and the negative control (anti-miR-NC: 5'-GGACAGGAUGGUCGAAACUGGU-3'); and small interfering RNA for STAT1 (si-STAT1: 5'-CCGGCTGGAAGATTTACAAGATGAACTCGAGTTCATCTTGTAAATCTTCCAGTTTTTG-3') and the negative control (si-NC: 5'-CCGGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTG-3'). These were purchased from Guangzhou RiboBio Co., Ltd. THP-1 cells were transfected with 0.5 µg of the aforementioned oligonucleotides using 0.6 µl of Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). After 24 h, THP-1 cells treated with 1 µg/ml LPS and untreated cells were incubated for a further 24 h at 37˚C prior to further experimentation.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!