Log In Sign up
The largest database of trusted experimental protocols

Piggybac transposase

Manufactured by System Biosciences
Visit Supplier

The PiggyBac transposase is a genetic engineering tool used for the integration of DNA sequences into the host genome. It facilitates the efficient insertion of genetic cargo into the genome by recognizing and binding to specific DNA sequences. The PiggyBac transposase catalyzes the transfer of the genetic material from the delivery vector to the target genomic location.

Automatically generated - may contain errors

Lab products found in correlation

Piggybac vector, by System Biosciences (6 mentions) Ptre tight, by Takara Bio (2 mentions) Piggybac transposon vector, by System Biosciences (2 mentions) Pgl4.10 luciferase, by Promega (2 mentions) Puc19, by New England Biolabs (2 mentions) Lipofectamine ltx with plus reagent, by Thermo Fisher Scientific (2 mentions) Piggybac pbcag egfp vector, by Addgene (2 mentions) Amaxa nucleofector 1, by Lonza (2 mentions) Vpg 1004, by Lonza (2 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions) Q5 site directed mutagenesis kit, by New England Biolabs (1 mentions) 4d nucleofector, by Lonza (1 mentions) P3 primary cell kit, by Lonza (1 mentions) 2 well slides, by Ibidi (1 mentions) Eclipse ti, by Nikon (1 mentions) Facsaria 2, by BD (1 mentions)

9 protocols using piggybac transposase

1

mCherry-PDEδ Construct Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Eight silent point mutations were introduced into the targeting region of the PDEδ shRNA of a previously published mCherry‐PDEδ construct9 using Q5® Site‐Directed Mutagenesis Kit (New England BioLabs, NEB, Frankfurt, Germany) according to the manufacturer's protocol. After sequence validation, the mutated mCherry‐PDEδ construct was cloned into a PiggyBac vector (System Bioscience, Palo Alto, CA) utilizing the restriction enzymes SpeI and NotI (NEB). Afterwards, HCT‐116 cells were co‐transfected with the above described construct and a PiggyBac transposase (System Bioscience, ratio 1:1) to enable genome integration. Stable transfected cells were selected by fluorescence activated cell sorting (FACS) based on mCherry fluorescence one week after transfection.
Klein C.H., Truxius D.C., Vogel H.A., Harizanova J., Murarka S., Martín‐Gago P, & Bastiaens P.I. (2018). PDEδ inhibition impedes the proliferation and survival of human colorectal cancer cell lines harboring oncogenic KRas. International Journal of Cancer, 144(4), 767-776.
+ Open protocol
+ Expand
2

Modular Inducible Genetic Cargo System

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pTETRIS-Cargo vector was created from components of a cumate-inducible piggyBAC transposon vector (System Biosciences), pGl4.10-Luciferase (Promega), and pTRE-Tight (Clontech). Briefly, a 567bp fragment containing a minimal mouse PGK promoter was cloned into a SacI site in pGl4.10-Luciferase to generate pGI4-PGK-Luc-pA. The reverse complement of PGK-Luc-pA was cloned into a vector containing the bovine growth hormone polyA site. The entire bGHpa-[reversePGK-Luc-pA] was cloned into NotI and SalI sites of the piggyBAC vector (System Biosciences). The cumate-inducible promoter in the piggyBAC vector was then replaced with the Tetracycline Responsive Element (TRE) from pTRE-Tight (Clontech) via Gibson assembly to generate pTETRIS-Cargo in Fig. 4A, in which the lncRNA, the luciferase gene, and a gene encoding puromycin resistance are all flanked by chicken HS4 insulator elements, and inverted terminal repeats (ITRs) recognized by the piggyBAC transposase. The rtTA-cargo vector from Fig. 4A was generated by cloning the hUbiC-rtTA3-IRES-Neo cassette from pSLIK-Neo (Addgene Plasmid #25735) into SfiI and SalI sites in a piggyBAC transposon vector (System Biosciences). The piggyBAC transposase from System Biosciences was cloned into SmaI and HindIII sites into pUC19 (NEB) to allow propagation of the transposase on ampicillin plates.
Kirk J.M., Kim S.O., Inoue K., Smola M.J., Lee D.M., Schertzer M.D., Wooten J.S., Baker A.R., Sprague D., Collins D.W., Horning C.R., Wang S., Chen Q., Weeks K.M., Mucha P.J, & Calabrese J.M. (2018). Functional classification of long non-coding RNAs by kmer content. Nature genetics, 50(10), 1474-1482.
+ Open protocol
+ Expand
3

CRISPR-Mediated BRCA2 Mutation Correction

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The BRCA2 mutation was edited using dimeric CRISPR RNA-guided FokI nucleases and a dual positive/negative selection strategy using piggyBac transposase (Yusa, 2013 (link)). Briefly, sgRNA targeting sites near the BRCA2 mutation (GCTGCATTTTTATTTTTGCA and ATCTAATAGTAATAATTTTG) were designed using http://zlab.bio/guide-design-resources and cloned into pXFokI-dCas9, a gift from Bruce Conklin (Addgene Plasmid #60901) (Miyaoka et al., 2016 (link)). Homology arms were derived from PCR amplification of the wild-type chromosome, spanning 1,330 bp, ranging from chr12:32,913,238–32,914,568. A homology-repair template with the wild-type allele was provided on a plasmid containing a PuroΔTK drug selection cassette flanked by piggyBac ITR sites, coinciding with the TTAA at chr13:32,913,972–32,913,975 (Yusa et al., 2011 (link)). Plasmids were transiently transfected with nucleofection using the 4D-Nucleofector (Lonza) and the P3 Primary Cell kit (Lonza). Homology-directed repair was selected for using puromycin (500 ng/ml), and positive colonies were isolated and verified using PCR Sanger sequencing. Positive clones were nucleofected with a plasmid expressing excision-only mutant piggyBac transposase (System Biosciences). Negative selection for the PuroΔTK cassette was performed using FIAU (250 nM), and surviving colonies were isolated and verified using PCR and Sanger sequencing.
Gruber J.J., Chen J., Geller B., Jäger N., Lipchik A.M., Wang G., Kurian A.W., Ford J.M, & Snyder M.P. (2019). Chromatin Remodeling in Response to BRCA2-Crisis. Cell reports, 28(8), 2182-2193.e6.
+ Open protocol
+ Expand
4

Modular Inducible Genetic Cargo System

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pTETRIS-Cargo vector was created from components of a cumate-inducible piggyBAC transposon vector (System Biosciences), pGl4.10-Luciferase (Promega), and pTRE-Tight (Clontech). Briefly, a 567bp fragment containing a minimal mouse PGK promoter was cloned into a SacI site in pGl4.10-Luciferase to generate pGI4-PGK-Luc-pA. The reverse complement of PGK-Luc-pA was cloned into a vector containing the bovine growth hormone polyA site. The entire bGHpa-[reversePGK-Luc-pA] was cloned into NotI and SalI sites of the piggyBAC vector (System Biosciences). The cumate-inducible promoter in the piggyBAC vector was then replaced with the Tetracycline Responsive Element (TRE) from pTRE-Tight (Clontech) via Gibson assembly to generate pTETRIS-Cargo in Fig. 4A, in which the lncRNA, the luciferase gene, and a gene encoding puromycin resistance are all flanked by chicken HS4 insulator elements, and inverted terminal repeats (ITRs) recognized by the piggyBAC transposase. The rtTA-cargo vector from Fig. 4A was generated by cloning the hUbiC-rtTA3-IRES-Neo cassette from pSLIK-Neo (Addgene Plasmid #25735) into SfiI and SalI sites in a piggyBAC transposon vector (System Biosciences). The piggyBAC transposase from System Biosciences was cloned into SmaI and HindIII sites into pUC19 (NEB) to allow propagation of the transposase on ampicillin plates.
Kirk J.M., Kim S.O., Inoue K., Smola M.J., Lee D.M., Schertzer M.D., Wooten J.S., Baker A.R., Sprague D., Collins D.W., Horning C.R., Wang S., Chen Q., Weeks K.M., Mucha P.J, & Calabrese J.M. (2018). Functional classification of long non-coding RNAs by kmer content. Nature genetics, 50(10), 1474-1482.
+ Open protocol
+ Expand
5

Rapamycin-Induced Protein Translocation

Check if the same lab product or an alternative is used in the 5 most similar protocols
HeLa cells were transfected with the DiPD plasmid together with a plasmid encoding a PiggyBac transposase (System Biosciences) using Lipofectamine 3000 (Thermo Fisher Scientific). Cells stably expressing DiPD were selected with hygromycin at 150 µg/ml followed by purification with FACS (FACSAria II, BD Biosciences). To deplete the GFP fused membrane or cytoplasmic proteins, the stable DiPD cells were transiently transfected with a plasmid encoding the GFP fusion. Cells were cultured and selected with antibiotics (blasticidin S: 6 µg/ml; G418: 150 µg/ml), then cell mixtures were seeded into 8-well or 2-well µslides (ibidi GmbH). Cells were treated with 250 nM rapamycin and imaged immediately with a spinning disc confocal microscope (Eclipse Ti, Nikon) equipped for live cell culture (with heating and humidified CO2 supply). GFP and DsRed were excited with 488 nm and 561 nm lasers, respectively, and cells were imaged every 30 min for about 24 h. Acquired images were processed and organized with imageJ.
Deng W., Bates J.A., Wei H., Bartoschek M.D., Conradt B, & Leonhardt H. (2020). Tunable light and drug induced depletion of target proteins. Nature Communications, 11, 304.
+ Open protocol
+ Expand
6

Engineered POLQ Mutants in RPE1b Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Wild type (WT) full length POLQ cDNA was assembled by PCR with a FLAG-P2A-BLAST cassette and subsequently cloned by Gibson assembly (New England BioLabs, #E2611L) in the PiggyBac PBCAG-eGFP vector (Addgene #40973) using BsrGI and SbfI sites to obtain the PiggyBac-eGFP-POLQ-FLAG-P2A-BLAST vector (referred here as GFP-Polθ WT). Point mutations were introduced using PCR mutagenesis and Gibson assembly in active sites as follow: Helicase (K121A, DE-216/7-AA), polymerase (DE-2540/1-AA), helicase/polymerase (K121A, DE-216/7-AA, DE-2540/1-AA). RPE1b POLQ−/− cells were complemented with GFP-Polθ WT and mutant constructs. Cells were plated in a 6-well plate, transfected the day after with 1 μg of PiggyBac vector and 0.5 μg of PiggyBac transposase (System Biosciences, #PB210PA-1) using Lipofectamine LTX with Plus Reagent (Thermo Fisher) and selected with Blasticidin (21 μg/ml) for 10 days. Vectors expression was confirmed by Western Blot.
Zhou J., Gelot C., Pantelidou C., Li A., Yücel H., Davis R.E., Farkkila A., Kochupurakkal B., Syed A., Shapiro G.I., Tainer J.A., Blagg B.S., Ceccaldi R, & D’Andrea A.D. (2021). A first-in-class Polymerase Theta Inhibitor selectively targets Homologous-Recombination-Deficient Tumors. Nature cancer, 2(6), 598-610.
+ Open protocol
+ Expand
7

Stable Cell Line Generation via PB-TRE-dCas9-VPR

Check if the same lab product or an alternative is used in the 5 most similar protocols
The PB-TRE-dCas9-VPR construct (Addgene #63800)73 was used to create a stable line using Piggybac transposase (System Biosciences). A total of 500,000 cells were transfected using the mouse neural stem cell nucleofection kit (Lonza, VPG-1004) with 0.66 μg of the construct and 0.33 μg of transposase using the Lonza Amaxa Nucleofector I with protocol A-33, followed by selection with hygromycin B at 50 ug/mL for 7 days.
Nikolic A., Maule F., Bobyn A., Ellestad K., Paik S., Marhon S.A., Mehdipour P., Lun X., Chen H.M., Mallard C., Hay A.J., Johnston M.J., Gafuik C.J., Zemp F.J., Shen Y., Ninkovic N., Osz K., Labit E., Berger N.D., Brownsey D.K., Kelly J.J., Biernaskie J., Dirks P.B., Derksen D.J., Jones S.J., Senger D.L., Chan J.A., Mahoney D.J., De Carvalho D.D, & Gallo M. (2023). macroH2A2 antagonizes epigenetic programs of stemness in glioblastoma. Nature Communications, 14, 3062.
+ Open protocol
+ Expand
8

Engineered POLQ Mutants in RPE1b Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Wild type (WT) full length POLQ cDNA was assembled by PCR with a FLAG-P2A-BLAST cassette and subsequently cloned by Gibson assembly (New England BioLabs, #E2611L) in the PiggyBac PBCAG-eGFP vector (Addgene #40973) using BsrGI and SbfI sites to obtain the PiggyBac-eGFP-POLQ-FLAG-P2A-BLAST vector (referred here as GFP-Polθ WT). Point mutations were introduced using PCR mutagenesis and Gibson assembly in active sites as follow: Helicase (K121A, DE-216/7-AA), polymerase (DE-2540/1-AA), helicase/polymerase (K121A, DE-216/7-AA, DE-2540/1-AA). RPE1b POLQ−/− cells were complemented with GFP-Polθ WT and mutant constructs. Cells were plated in a 6-well plate, transfected the day after with 1 μg of PiggyBac vector and 0.5 μg of PiggyBac transposase (System Biosciences, #PB210PA-1) using Lipofectamine LTX with Plus Reagent (Thermo Fisher) and selected with Blasticidin (21 μg/ml) for 10 days. Vectors expression was confirmed by Western Blot.
Zhou J., Gelot C., Pantelidou C., Li A., Yücel H., Davis R.E., Farkkila A., Kochupurakkal B., Syed A., Shapiro G.I., Tainer J.A., Blagg B.S., Ceccaldi R, & D’Andrea A.D. (2021). A first-in-class Polymerase Theta Inhibitor selectively targets Homologous-Recombination-Deficient Tumors. Nature cancer, 2(6), 598-610.
+ Open protocol
+ Expand
9

Inducible dCas9-VPR Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Generation of an inducible overexpression line. The PB-TRE-dCas9-VPR construct (Addgene #63800) (Chavez et al., 2015) was used to create a stable line using Piggybac transposase (System Biosciences). A total of 500,000 cells were transfected using the using the mouse neural stem cell nucleofection kit (Lonza, VPG-1004) with 0.66 µg of the construct and 0.33 µg of transposase using the Lonza Amaxa Nucleofector I with protocol A-33, followed by selection with hygromycin B at 50 ug/mL for 7 days. Generation of sgRNA plasmids. Guide RNAs were designed using the crispr.mit.edu guide design tool, using as templates the DNAse accessible region directly upstream of the TSS of H2AFY2 (Kent et al., 2002) . The plasmid backbone pLKO-sgRNA-GFP (Addgene #57822) was used and sgRNA plasmids were constructed using BsmBI digestion followed by ligation, as previously described (Heckl et al 2014) . Transfection for overexpression experiments. Two million cells containing the dCas9-VPR construct were transfected with a pool of multiple guides targeting H2AFY2 or a non-targeting control using the Amaxa Nucleofector. Doxycycline (2 µg/mL) was added to media 24 hours after transfection.
Nikolić A., Bobyn A., Maule F., Ellestad K., Lun X., Johnston M.J., Gafuik C., Zemp F.J., Paik S., Ninkovic N., Solovyov A., Mehdipour P., Shen Y., Berger N.D., Brownsey D.K., Dirks P.B., Derksen D.J., Jones S.J., Carvalho D.D.D., Senger D.L., Chan J.A., Mahoney D.J., & Gallo M. (2021). macroH2A2 shapes chromatin accessibility at enhancer elements in glioblastoma to modulate a targetable self-renewal epigenetic network.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!