Ab50391
Ab50391 is a laboratory equipment product. It is designed for use in scientific research applications.
Lab products found in correlation
4 protocols using ab50391
Immunofluorescence Assay for Focal Adhesion Proteins
Integrin β1 signaling modulation
Primers for cloning human DN-ITGβ1 into pCS2 c-terFlag were Inte-Forward: GGCGGATCCACCATGAATTTACAACCAATTTTCTG, Inte-Reverse: GGCATCGAT TATCATTAAAAGCTTCCATATCAG. Primers for cloning human ITGβ1-WT into pCS2 Inte-WT- Reverse: GGCATCGATTTTTCCCTCATACTTCGGA. Pools of 3 target-specific ITGβ1 (sc-35674) and control siRNAs (sc-37007) were obtained from Santa Cruz Biotechnology. Xenopus laevis ITGβ1 antisense MO, sequence 5’GTGAATACTGGATAACGGGCCATCT3’, was designed with the help of GeneTools.
Cytoskeletal Protein Immunostaining Protocol
Antibody Validation for Cell Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!