Human gastric cancer PDC, JSC15‐3, JSC17‐2 and JSC17‐7, were established with approval from the Institutional Review Board of the Japanese Foundation for Cancer Research and with informed consent from the patients as described previously.12 JSC15‐3 and JSC17‐2 cells were cultured in ACL4/F12 (1:1) medium (Nacalai Tesque) supplemented with 5% heat‐inactivated FBS and 100 μg/mL kanamycin (Meiji Seika Pharma). JSC17‐7 cells were cultured in ACL4/RPMI (1:1) medium supplemented with 5% heat‐inactivated FBS and 100 μg/mL kanamycin. 5‐fluorouracil (5‐FU), SN38, paclitaxel and temsirolimus were purchased from Sigma‐Aldrich. Cisplatin was purchased from Enzo Biochem.
Kanamycin
Manufactured by Meiji Seika Pharma
Sourced in Japan, United States
Kanamycin is a broad-spectrum antibiotic used in laboratory settings. It functions as a selective agent, inhibiting the growth of bacteria that lack resistance to the antibiotic.
Automatically generated - may contain errors
Lab products found in correlation
Amphotericin b, by Bristol-Myers Squibb (6 mentions)
L glutamine, by Fujifilm (5 mentions)
Nahco3, by Fujifilm (3 mentions)
Veroe6 tmprss2 cell, by Japanese Collection of Research Bioresources Cell Bank (3 mentions)
Dulbecco s modified eagle s medium, by Nissui Pharmaceutical (3 mentions)
Kanamycin, by Fujifilm (2 mentions)
Dulbecco modified eagle medium (dmem), by Fujifilm (2 mentions)
Fetal bovine serum (fbs), by Fujifilm (2 mentions)
G418 disulfate, by Nacalai Tesque (2 mentions)
Paclitaxel, by Merck Group (1 mentions)
Temsirolimus, by Merck Group (1 mentions)
Cisplatin, by Enzo Life Sciences (1 mentions)
293ft human embryonic kidney cells, by Thermo Fisher Scientific (1 mentions)
Dulbecco s modified eagle s medium dmem, by Fujifilm (1 mentions)
Rcb0098, by RIKEN BioResource Center (1 mentions)
Millipore filter, by Merck Group (1 mentions)
Amphotericin, by MP Biomedicals (1 mentions)
Penicillin, by Meiji Seika Pharma (1 mentions)
Dmem high glucose, by Fujifilm (1 mentions)
Dmem low glucose, by Fujifilm (1 mentions)
17 protocols using kanamycin
1
Establishment and Culture of Human Gastric Cancer PDCs
2
Generation of EGFR Mutant Ba/F3 Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ba/F3 murine bone marrow-derived pro-B cells (purchased from RIKEN BRC) harboring EGFR mutations were cultured in low-glucose Dulbecco’s modified Eagle’s medium (DMEM; Wako) containing 10% fetal bovine serum (FBS), kanamycin, and 0.5 ng/mL of interleukin-3 (IL-3). 293FT human embryonic kidney cells (purchased from Invitrogen) were cultured in high-glucose DMEM supplemented with 10% FBS and kanamycin (Meiji Seika Pharma). EGFR-L747P, del19, L858R, del19/T790M, and L858R/T790M mutant Ba/F3 cells were generated by lentiviral infection produced by a pLenti6.3-EGFR-L747P del19, L858R, del19/T790M, or L858R/T790M plasmid and packaging plasmids as indicated below. All cells were regularly tested to ensure that they were free of mycoplasma contamination.
Primers
Mutagenesis primer for creating EGFR-L747P
- EGFR-L747P-F: CGTCGCTATCAAGGAACCAAGAGAAGCAACATCTCC
- EGFR-L747P-R: GGAGATGTTGCTTCTCTTGGTTCCTTGATAGCGACG
Sequencing primers for EGFR
- EGFR ORF F1: GTGGCGGGACATAGTCAGCAGTG
- EGFR ORF F2: CCTCAGGCCATGAACATCACCTG
- EGFR ORF F3: CCGTGAGTTGATCATCGAATTC
- EGFR ORF R1: GAATTTGCGGCAGACCAGGCAG
- EGFR ORF R2: CTTCCGAACGATGTGGCGCCTTC
- EGFR ORF R3: CAGCTTTGCAGCCCATTTCTATC
Sequencing primers for EGFR exon19
- hEGFR-Ex19-F: GGCAGCATGTGGCACCATC
- hEGFR-Ex19-R: GCCTGAGGTTCAGAGCCATG
- hEGFR-Ex19-Fseq: GATCCCAGAAGGTGAGAAAG
- hEGFR-Ex19-Rseq: GAGGATTTCCTTGTTGGC.
Primers
Mutagenesis primer for creating EGFR-L747P
- EGFR-L747P-F: CGTCGCTATCAAGGAACCAAGAGAAGCAACATCTCC
- EGFR-L747P-R: GGAGATGTTGCTTCTCTTGGTTCCTTGATAGCGACG
Sequencing primers for EGFR
- EGFR ORF F1: GTGGCGGGACATAGTCAGCAGTG
- EGFR ORF F2: CCTCAGGCCATGAACATCACCTG
- EGFR ORF F3: CCGTGAGTTGATCATCGAATTC
- EGFR ORF R1: GAATTTGCGGCAGACCAGGCAG
- EGFR ORF R2: CTTCCGAACGATGTGGCGCCTTC
- EGFR ORF R3: CAGCTTTGCAGCCCATTTCTATC
Sequencing primers for EGFR exon19
- hEGFR-Ex19-F: GGCAGCATGTGGCACCATC
- hEGFR-Ex19-R: GCCTGAGGTTCAGAGCCATG
- hEGFR-Ex19-Fseq: GATCCCAGAAGGTGAGAAAG
- hEGFR-Ex19-Rseq: GAGGATTTCCTTGTTGGC.
3
Establishment and Characterization of Gastric Cancer PDC Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gastric cancer PDC lines JSC15-3 and JSC18-1 were established in JFCR from 2015 to 2018 under approval from the Institutional Review Board of JFCR, with written informed consent from patients in accordance with Declaration of Helsinki, as described previously (20 (link)). JSC15-3 cells were cultured in ACL4/F12 (1:1) medium (Nacalai Tesque) supplemented with 5% heat-inactivated FBS and 100 µg/mL kanamycin (Meiji Seika Pharma). JSC18-1 cells were cultured in ACL4/RPMI (1:1) medium supplemented with 5% heat-inactivated FBS and 100 µg/mL kanamycin. Cells were routinely tested for Mycoplasma contamination by PCR using the primers 5′-CACCATCTGTCACTCTGTTAACC-3′ and 5′-GGAGCAAACAGGATTAGATACCC-3′. Mycoplasma testing was also performed in 2021 by ICLAS monitoring center, Central Institute for Experimental Animals (Kanagawa, Japan).
4
Establishing Cisplatin-Resistant A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cisplatin-resistant A549 cisR cells were established as previously described for HeLa cisR cells. Briefly, parental human lung carcinoma A549 cells (RCB0098; freshly obtained from RIKEN Bio Resource Center) were maintained in growth medium composed of Dulbecco's modified eagle medium (DMEM; Wako Chemicals) with 10% FBS and 60 µg/ml kanamycin (Meiji Seika Pharma, Tokyo, Japan). By subculturing these cells in the presence of incrementally increasing concentrations of cisplatin, we established a highly resistant subline, A549 cisR cells, which were maintained in growth medium containing 3 µg/ml cisplatin.
5
Isolation and Concentration of SHED Secretome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SHEDs were cultured, and the medium was changed to serum-free alpha-minimal essential medium (α-MEM) supplemented with 0.5 μL/mL penicillin (Meiji Seika Pharma, Tokyo, Japan), 0.24 μL/mL kanamycin (Meiji Seika Pharma), and 1 μL/mL amphotericin (MP Biomedicals, Strasbourg, France) after reaching 70–80% confluence. After 48 h of incubation, the culture supernatant was centrifuged at 390× g for 5 min and at 1580× g for 3 min. The supernatant (SHED-CM) was enriched 20-fold using a 10-kDa Millipore filter (Millipore EMD, Burlington, MA, USA) and stored at 4 °C or −80 °C until further use.
6
Culturing Diverse Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ba/F3 immortalized murine bone marrow-derived pro-B cells were cultured in Dulbecco’s minimal essential medium (DMEM) low glucose (Wako) supplemented with 10% fetal bovine serum (FBS) and 250 µg/ml kanamycin (Meiji Seika Pharma) (D-10) with or without 0.5 ng/ml of interleukin (IL)-3 (Invitrogen). Human epidermoid carcinoma cell line A431 and human adenocarcinoma cell line A549 were cultured in D-10. PC9, a human cancer cell line derived from lung adenocarcinoma cells, was cultured in RPMI 1640 (Wako) supplemented with 10% FBS and kanamycin (R-10). 293FT human embryonic kidney cells were cultured in DMEM high glucose (Wako) supplemented with 10% FBS. Detailed information about the reagents used in this study is described in Supplementary Table 2 .
7
Partial Sciatic Nerve Ligation in Rats
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eighty-four male Sprague-Dawley rats were divided into groups of 12. The partial sciatic nerve ligation (PSL) model was prepared according to a previously used method (Seltzer et al., 1990) . Under 2% isoflurane anesthesia (Escain, Mylan Inc., Osaka, Japan), the left femoral skin was incised and the sciatic nerve was exposed. Approximately one-half to one-third of the sciatic nerve was tightly ligated with surgical 8-0 silk thread. The surgical area was sterilized with kanamycin (Meiji Seika Pharma Co., Ltd., Tokyo, Japan) and was sutured with surgical 4-0 silk thread. Twelve days after PSL, the paw withdrawal threshold was measured using the Dynamic Plantar Aesthesiometer (model 37400; Ugo Basile, Varese, Italy). Mechanical stimulation was applied to the left hind paw in a stepwise manner (from 0 to 30 g in 40 seconds, at 0.5 g/step). PSL rats with a paw withdrawal threshold of 7 g or less were selected and assigned to treatment groups. The rats received the test compound or vehicle (control) orally, and the paw withdrawal threshold was measured at 0 hours (before administration), and at 2, 4, 6, and 8 hours after administration. The area under the curve (AUC) of the 8-hour paw withdrawal threshold (AUC 0-8 hours ) was calculated by the trapezoidal method.
8
Antibiotics Purchase and Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ampicillin (AMP) and kanamycin (KAN) were purchased from Meiji Seika Pharma (Tokyo, Japan). Cefepime (FEP) was purchased from Bristol-Myers Squibb (New York, NY, USA). Colistin (CST), minocycline (MIN), polymyxin B (PMB), and tetracycline (TET) were purchased from Sigma-Aldrich Co. (St Louis, MO, USA). AMK and tigecycline (TGC) were purchased from Wako Pure Chemical Industries (Osaka, Japan). Sitafloxacin (STX) was purchased from Cimic CMO (Tokyo, Japan). Cefozopran (ZOP), doxycycline (DOX), and IPM were generously provided by Takeda Pharmaceutical (Osaka, Japan), Pfizer (New York, NY, USA), and Banyu Pharmaceutical (Tokyo, Japan), respectively. CIP, sparfloxacin (SPX), and meropenem (MEM) were generously provided by Sumitomo Dainippon Pharma (Osaka, Japan). Lysogeny broth (LB; Miller), LB ager (Miller), and Muller Hinton Broth II (MHB II) were purchased from Becton Dickinson (Franklin Lakes, NJ, USA). Cation-adjusted MHB II was prepared by adding CaCl2 and MgCl2 (Wako Pure Chemical Industries) at the final concentrations of 50 mg/L Ca2+ and 25 mg/L Mg2+ to autoclaved MHB II. Saline was prepared as 0.9% NaCl (Wako Pure Chemical Industries).
9
EML4-ALK Variants and Inhibitor Impacts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ba/F3 immortalized murine bone marrow‐derived pro‐B cells were cultured with Dulbecco's modified Eagle medium (DMEM) low glucose supplemented with 10% fetal bovine serum (FBS) and kanamycin (250 mg/mL; Meiji Seika Pharma, Tokyo, Japan) and 0.5 ng/mL of interleukin‐3 (IL‐3). Human kidney embryo cell lines, 293FT cells were cultured in DMEM high glucose with 10% FBS. The cells were infected with lentivirus replicated in 293FT cells by transforming them with paging plasmids (Virapower), which express rearranged cDNA regions encoding EML4‐ALK variant 1 and either WT or different mutations (I1171S and I1171S + G1269A). Cells were selected with blasticidin (7 μg/mL) for one week. After selection, IL‐3 was withdrawn from the culture medium.
Crizotinib (PF‐02341066), lorlatinib (PF‐06463922), and brigatinib (AP26113) were obtained from Shanghai Biochempartner (Shanghai, China). Alectinib (CH5424802), and ceritinib (LDK‐378) was purchased from ActiveBiochem (Hong Kong).
Crizotinib (PF‐02341066), lorlatinib (PF‐06463922), and brigatinib (AP26113) were obtained from Shanghai Biochempartner (Shanghai, China). Alectinib (CH5424802), and ceritinib (LDK‐378) was purchased from ActiveBiochem (Hong Kong).
10
Propagation and Purification of Influenza A Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
IAV subtype H1N1 (A/Puerto Rico/8/1934 strain: ATCC® Catalog No. VR-95TM) was obtained from ATCC (Manassas, VA, USA), then propagated via inoculation into the allantoic cavity of 10-day-old embryonated chicken eggs. Allantoic fluids containing IAV were used as viral solutions unless otherwise stated. To prepare purified IAV, which was used for some studies, sucrose gradient ultracentrifugation was performed as previously mentioned [21 (link)]. A Micro BCA protein assay kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) was used to estimate the purified IAV protein concentration. Madin–Darby canine kidney (MDCK) cells were kindly provided by Dr. H. Nagano (Hokkaido Institute of Public Health, Sapporo, Japan). For MDCK cell culture, Dulbecco’s modified Eagle’s minimal essential medium (DMEM; Nissui Pharmaceutical Co., Ltd., Tokyo, Japan) supplemented with 10% fetal bovine serum, 2 mM l -glutamine, 0.15% NaHCO3 (FUJIFILM Wako Pure Chemical Co., Osaka, Japan), 2 μg/mL amphotericin B (Bristol-Myers Squibb Co., New York, NY, USA), and 100 μg/mL kanamycin (Meiji Seika Pharma Co., Ltd., Tokyo, Japan) was used as the growth medium. Following viral inoculation, viral growth medium consisted of DMEM supplemented with 0.2% bovine serum albumin, 0.15% NaHCO3, 0.01% glucose, 2.5 mM HEPES, and 0.0006% trypsin (FUJIFILM Wako Pure Chemical Co.) was used for MDCK cell culture.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!