Total RNA from untreated cells or transfected cells was isolated using Trizol Reagent. RT-PCR was performed by using the PrimeScript RT reagent Kit and Multiplex PCR Assay Kit according to the manufacturer's instructions (TaKaRa Biotechnology, Dalian, China). PCR products were identified by electrophoresis with 1.5% agarose gels and recorded using the Gel imaging system (Bio-Rad, CA, USA). GAPDH RNA was served as an input control.
Multiplex pcr assay kit
Manufactured by Takara Bio
Sourced in Japan
The Multiplex PCR Assay Kit is a laboratory equipment designed for the simultaneous amplification of multiple DNA sequences in a single reaction. It enables the efficient and accurate detection of various target genes or genomic regions within a sample.
Automatically generated - may contain errors
Lab products found in correlation
Primescript rt reagent kit, by Takara Bio (1 mentions)
Gel imaging system, by Bio-Rad (1 mentions)
Rnaqueous micro total rna isolation kit, by Thermo Fisher Scientific (1 mentions)
Minibest agarose gel dna extraction kit ver 3, by Takara Bio (1 mentions)
Vahts library quantification kit, by Illumina (1 mentions)
Qscript flex cdna kit, by Quantabio (1 mentions)
Dna isolation kit, by Qiagen (1 mentions)
Nanodrop, by Thermo Fisher Scientific (1 mentions)
4 protocols using multiplex pcr assay kit
1
Total RNA Isolation and RT-PCR Analysis
2
Microsatellite Genotyping Using Multiplex PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used 12 autosomal microsatellite loci, which have been described in other studies [27 (link)–30 (link)]. Amplifications were performed using fluorescently-labeled forward primers (FAM, VIC, NED, and PET) in a reaction volume of 10 μl, containing 1 μl template DNA, 0.05 μl Multiplex PCR mix 1 and 5.0 μl Multiplex PCR mix 2 (Multiplex PCR Assay Kit, Takara), 0.2 μl (10 mM) primers, and 3.55 μl of water. Amplification included an initial denaturation step at 94°C for 1 min, followed by 94°C for 30 s of denaturation, 30 cycles each of 90 s at 57°C for annealing, 90 s at 72°C for extension, and a final extension step at 72°C for 10 min. PCR products were diluted from ×1 to ×20 according to the thickness of the band from the electrophoresis results, and four different fluorescence samples were pooled to be genotyped on an ABI 3130 sequencer. Alleles were scored using the software Peak Scanner v1.5 (Applied Biosystems) and the scored peaks were manually edited. Micro-Checker v2.2.3 was used to check for null alleles, and two loci were dropped due to the presence of null alleles [31 ], resulting in using 10 loci for further analyses.
3
TCR-β CDR3 region sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen CTLs were thawed, and RNA was isolated using an RNAqueous™-Micro Total RNA Isolation Kit (Life Technologies, USA). A total of 500 ng RNA of each sample was reverse transcribed into complementary DNA (cDNA) with a universal constant region primer for TCRβ (ATCTCTGCTTCTGATGGCTCA) using a qScript Flex cDNA Kit (Quantabio, USA). Multiplex PCR was then conducted to amplify the entire CDR3 region using a Multiplex PCR Assay Kit (TaKaRa, Japan) with forward primers specific to V segments and a reverse primer targeting the C region.23 (link) PCR products were loaded onto a 2.5% agarose gel (Sigma, USA). After 90 min of electrophoresis at 130 V, bands centered at 300 bp were extracted (TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.3.0). Real-time fluorescence quantitative PCR was used to quantify the absolute concentration of the purified fragment (VAHTS Library Quantification Kit for Illumina). Based on their concentrations, all libraries were pooled and subjected to sequencing using the HiSeq X Ten platform under a 150 bp paired-end strategy. About 1.5 GB data were generated for each sample, which contains about five millions of reads to ensure enough depth.
4
Multiplex PCR for GSTM1 and GSTT1 Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated using the QIAGEN DNA isolation kit following the manufacturer's protocol (QIAGEN, Hilden, Germany). The DNA concentration and quality were measured using the NanoDrop instrument (NanoDrop Technologies, Wilmington, DE, USA) and by agarose gel electrophoresis. The GSTM1 and GSTT1 genotypes were determined simultaneously in a single multiplex PCR assay (Figure 1(a) ). Briefly, isolated DNA (20 ng) was amplified in a 25 μL reaction mixture containing 10 pmol GSTM1 (5′-GAACTCCCTGAAAAGCTAAAGC and 5′-GTTGGGCTCAAATATACGGTGG) and GSTT1 (5′-TICCTTACTGGTCCTCACATCTC and 5′-TCACCGGATCATGGCCAGCA) primers. As an internal control, albumin was coamplified using the primers 5′-GCCCTCTGCTAACAAGTCCTAC and 5′-GCCCTAAAAAGAAAATCGCCAATC. PCR was performed using the Multiplex PCR assay kit (Takara Bio, Shiga, Japan) under the following protocol: 5 min at 94°C, followed by 30 cycles at 94°C for 1 min, 63°C for 1 min, and 72°C for 1 min. The PCR products were analyzed electrophoretically on ethidium bromide-stained 1.5% agarose gels. The absence of GSTM1 or GSTT1 PCR products was defined as the null genotype (Figure 1(b) ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!