Turbo dna free kit

RNA was isolated from fragments of tumor tissue or cells cultured in T75 flasks using the column method (RNeasy Mini Kit; Qiagen, Germany). The samples were freed from DNA using the TURBO DNA-free kit (Thermo Fisher Scientific, USA), and reverse transcription was performed using 2 µg of total RNA for the tumor samples and 1.5 µg for the cell culture samples (High-Capacity cDNA Reverse Transcription Kit; Thermo Fisher Scientific, USA). Real-time PCR was performed using TaqMan™ Gene Expression Master Mix with TaqMan probes (all from Thermo Fisher Scientific, USA; listed in Table 2), or using PowerUp SYBR Master Mix (Thermo Fisher Scientific, USA) with the primers listed in Table 2. Reactions were run on a Bio-Rad CFX384 qPCR system (BioRad, Hercules, CA, USA). The relative mRNA levels were calculated using the 2(-Delta C[T]) method, with normalization to the expression of β-Actin as a housekeeping gene.Table 2

List of TaqMan probes and primers sequences used in real-time PCR

	TaqMan probes (Assay ID)
Vegfa	Mm00437306
Pten	Mm00477208
Akt1	Mm00437306
p53	Mm01731287
β-Actin	Mm02619580
	Primers sequences
	Forward	Reverse
Serpine1 (PAI-1)	CCTCCACAGCCTTTGTCATCT	TTCGTCCCAAATGAAGGCGT
Mmp9	CAGCCGACTTTTGGTCTTC	CGGTACAAGTATGCCTCTGCCA
Acta2 (α-SMA)	CTTCGTGACTACTGCCGGAGC	AGGTGGTTTCGTGGATGCC
β-Actin	CCTAGGCACCAGGGTGTGA	GTTGGCCTTAGGGTTCAGGG
Vegfr2	AAACAAAACTGTAAGTACGCTGGTC	GCAGCAGGTTGCACAGTAATTT

Bacterial pellets were re-suspended in RLT buffer (QIAGEN, Hilden, Germany), transferred to screw-cap tubes containing 250 mg of 0.1 mm zirconia/silica beads (BioSpec Products, Bartlesville, OK, USA) and disrupted by bead beating for 1 min for four times, each followed by 1 min on ice, using a Mini-Beadbeater-8 instrument (BioSpec Products, Bartlesville, OK, USA). RNA was then extracted with RNeasy Protect Bacteria Mini Kit (QIAGEN, Hilden, Germany), following manufacturer’s instructions. Integrity of the RNA sample was verified on 1.5% denaturing agarose gel. Total RNA was treated with Turbo DNA-free kit (Thermo Fisher Scientific, Waltham, MA, USA), RNA concentration and purity were measured using NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA), and 1 µg of RNA was reverse transcribed with SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA) using random hexamers, according to the manufacturer’s protocol.

A 70 ml sample of whole blood was drawn from each of 4 healthy volunteers who had no history of chronic disease, no history of TB and who had a negative IGRA.
WBA cultures were set-up as described above, but with a 25-fold increase in volumes (to a total volume of 15 ml blood culture) whilst maintaining the ratios of blood and TB inoculum and the drug concentration unchanged. Cultures for the same eight drug/control conditions as described above were prepared in quadruplicate (each replicate assay prepared separately from the blood of one of the four healthy volunteers) and were incubated for 1 h (time selected from the kill curves, as above).
RNA was extracted from 15 ml whole blood cultures by adding Guanidium Thiocyanate solution for host cell lysis, followed by resuspension of cells in 1 ml TRIzol Reagent (Thermo Fisher Scientific, Massachusetts, USA) for Mtb inactivation, Mtb cells were mechanically lyzed using the FastPrep 24 Tissue Homogenizer (MP Biomedicals, California, USA) at 4x30s, 6.0 m/s followed by phenol-chloroform steps outlined in the TRIzol user manual. Samples were treated with DNAse-I using TURBO DNA-free kit (Thermo Fisher Scientific, Massachusetts, USA).

Differential gene expression was analyzed by qRT-PCR. P. xenovorans recombinant strains were grown in M9 minimal medium with 3-HPA or 4-HPA (5 mM) as sole carbon and energy source until exponential phase. Bacterial cells were harvested and the RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. Residual DNA was removed employing the TURBO DNA-free Kit (Thermo Fisher Scientific; Waltham, MA, USA). RNA quality was analyzed with the NanoDrop One spectrometer (Thermo Fisher Scientific; Waltham, MA, USA). RNA integrity was checked in a 1% w v⁻¹ agarose gel. cDNA was synthetized with the First Strand cDNA Synthesis Kit (Thermo Fisher Scientific; Waltham, MA, USA). The qRT-PCRs were carried out with the KAPA SYBR FAST qPCR Master Mix Kit (Kapa Biosystems; Boston, MA, USA), following the manufacturer’s instructions. The gyrB and ftsZ genes were used as reference genes. Quantitative RT-PCR analysis was performed on a Mx3000P qPCR system (Stratagene, Agilent Technologies, Santa Clara, California, USA). The results were analyzed using the Hellemans’ method [37 (link)]. The primers used in this study are listed in Additional file 1: Table S1.

H. mediterranei cells were cultured in MG medium at 37 °C. The total RNA was isolated from exponentially growing cells using TRIzol reagent (Invitrogen, USA)^{49 (link)}. RT-qPCR was used to analyze the gene transcriptional level. Ten microgram of total RNA was digested with TURBO DNA-free™ Kit (Thermo Fischer Scientific, USA) to remove DNA from samples. Then cDNA was synthesized from the DNA-free RNA samples using random hexamer primers and Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT) (Promega, USA). All real-time PCR were performed using KAPA™ SYBR^® Fast qPCR Kit (KAPA Biosystems, USA). The fold change of gene expression was analyzed by ViiA™ 7 Real-Time PCR System (Applied Biosystems, Inc., USA). 7S rRNA was used as the inner standard. The primers used are listed in Supplementary Data 2. RT-qPCR were performed in two or three replicates.

RNA was extracted using the RNAqueous™-Micro Total RNA Isolation Kit (ThermoFisher Scientific), followed by a DNAse treatment made with the TURBO DNA-free™ Kit (ThermoFisher Scientific) and finally purified a second time using the RNeasy MinElute Cleanup Kit (Qiagen). All steps were done according to the manufacturer's protocol.
Real-time PCR was performed using the SYBR Green Supermix (Biorad) with a Biorad’s thermal cycler using the following profile: 95 °C for 10 min; 40 cycles of amplification with successively 95 °C for 15 s, 60 °C for 10 s, and 72 °C for 20 s; one cycle for melting curve analysis with an acquisition every 0.5 °C from 65 °C to 95 °C to verify the presence of a single product. Each assay included a no-template control for each primer pair, and five successive dilutions to determine the Ct values and the reaction efficiencies. Real-time PCR reactions were done in triplicate. Gene expression level was normalized using Ci-actin as reference gene as previously described^{31 (link)–33 (link)}. Primer pair used for Ci-caspase 8/10 are: forward 5’-AAGACTGCTTTGTGTGCGTG-3’, reverse 5’-GGCAGGCTTGGAAGAAAAATAT-3’. PCR products length were between 140 and 160 bp.