For Luciferase assay, cells were transfected with empty vector or TFEB, together with firefly luciferase reporter pGL3-pS5 and renilla(as internal control, Luc:Ren = 30:1). 48 hours later, the cells were lysed for dual-luciferase bioluminescence assay analysis (E1910, Promega). For each experiment, samples were analyzed in triplicates. For Realtime PCR (qPCR), total RNAs were extracted from cells using Trizol. The full-length cDNA library was constructed by reverse transcription PCR using PrimeScriptTM RT Master Mix Perfect Realtime (#RR036A, Takara). qPCR was performed using iQ TM SYBR@ Green Supermix (1708882, BioRad) with BioRad CFX Connect real time PCR system. The specific primer sets are as follow: SCAMP5(F:5'TCTGGATGTTGAACAGCGTCA , R: 5'AAACCAGCAGACGTAGGAGC ); actin(F: 5'GGCTACAGCTTCACCACCAC , R: 5'GAGTACTTGCGCTCAGGAGG ); TFEB(F: 5'GGTGTTGAAGGTGCAGTCCT, R: 5'GTGGGCAGCAAACTTGTTCC ).
Primescript rt master mix perfect real time
Manufactured by Takara Bio
Sourced in Japan, China, United States
PrimeScript RT Master Mix Perfect Real Time is a ready-to-use reverse transcription (RT) and real-time PCR reagent mix. It is designed for the synthesis of first-strand cDNA and subsequent real-time PCR amplification of target sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (47 mentions)
Rnaiso plus, by Takara Bio (15 mentions)
Trizol reagent, by Takara Bio (13 mentions)
Tb green premix ex taq 2 tli rnaseh plus, by Takara Bio (13 mentions)
Sybr premix ex taq 2, by Takara Bio (10 mentions)
Trizol, by Thermo Fisher Scientific (8 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (8 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (8 mentions)
Rneasy mini kit, by Qiagen (7 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (5 mentions)
Abi prism 7500 fast real time pcr system, by Thermo Fisher Scientific (5 mentions)
Sybr premix ex taq 2 tli rnaseh plus, by Takara Bio (5 mentions)
Tb green premix ex taq 2, by Takara Bio (5 mentions)
Sybr premix ex taq, by Takara Bio (5 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (5 mentions)
Minibest universal rna extraction kit, by Takara Bio (4 mentions)
Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Sybr premix ex taq tli rnaseh plus, by Takara Bio (4 mentions)
Sybr premix ex taq kit, by Takara Bio (4 mentions)
Nanodrop lite, by Thermo Fisher Scientific (4 mentions)
180 protocols using primescript rt master mix perfect real time
1
Luciferase and qPCR Analysis of TFEB
2
Quantitative Analysis of Lung Immune Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Take the upper lobe of the left lung cryopreserved at −80 °C, total RNA was extracted by Trizol (BIO TNT) according to the manufacturer’s instruction, then the total RNA was reverse transcripted into the first strand of cDNA (PrimeScriptTMRT Master Mix (Perfect Real Time) Takara BIO INC) according to the instruction, the concentration and A260/280 of cDNA were checked to judge the purity of the sample extract. Real-time quantitative polymerase chain reaction (qPCR) experiment (TB Green® Premix Ex TaqTM II (Tli RNaseH Plus) Takara BIO INC) was performed to detect the expression level of IL-33, ST2, IL-4, IL-13, IL-5, TNF-a, IFN-γ (primer sequences are presented in Table 1 ), and the results were analyzed as previously reported (Wei et al. 2016 (link)).
3
Macrophage RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Macrophage-like cells were directly lysed with 700 μl of QIAzol® Lysis Reagent (Qiagen, Hilden, Germany). Total RNA extraction was performed with the miRNeasy Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. To quantify extracted RNA a NanoVue PlusTM spectrophotometer (GE Healthcare Life Sciences, Piscataway, NJ, United States) was used and the integrity/quality was assessed by 1% agarose gel stained with GelRed (Biotium, Hayward, CA, United States). For gene expression, 500 ng total RNA were reverse transcribed using PrimeScriptTM RT Master Mix (Perfect Real Time) (Takara Bio Inc.) according to the manufacturer’s instructions. The cDNA synthesis for three microRNAs (miR-126, miR-146a, and miR-346) was performed by TaqManTM MicroRNA Reverse Transcription Kit (Applied Biosystems) using 12.5 ng of total RNA.
4
Real-Time qRT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For real-time PCR, total RNAs were extracted from cells using Trizol. The full-length cDNA library was constructed by reverse transcription PCR using PrimeScriptTM RT Master Mix Perfect Realtime (RR036A, Takara). Quantitative reverse transcriptase PCR was performed using iQTM SYBR@ Green Supermix (1708882, Bio-Rad) with Bio-Rad CFX Connect real-time PCR system.
5
Comprehensive RT-qPCR Analysis of ceRNA Network
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Significant regulatory pathways were selected from the ceRNET for RT-qPCR verification of differential expression. The cDNA templates were synthesized using PrimeScriptTM RT Master Mix (Perfect Real Time) (Takara, Otsu, Japan, Product no: RR036A). RT-qPCR was performed using the SYBR Premix Ex TaqTM (Tli RNaseH Plus) (Takara, Otsu, Japan, Product no: TRR820A) and an LC480 Real-Time PCR System (Roche, Basel, Switzerland) in accordance with the manufacturer's specifications. Small RNA samples were isolated using the E.Z.N.A.TM miRNA Kit (OMEGA BIO-TEK. Product no: R6842-01). The miRcute Plus miRNA First Chain cDNA Synthesis Kit (Tiangen, Beijing, China. Product no: KP211) was used for cDNA synthesis. RT-qPCR was performed using the miRcute Plus miRNA qPCR Detection Kit (Tiangen, Beijing, China, Product no: FP411) and an LC480 instrument (Roche, Basel, Switzerland). GAPDH was used as the endogenous control for mRNAs and lncRNAs, and U6 was used as the endogenous control for miRNAs. We used the 2−ΔΔCt method to analyze the data. All samples were analyzed in triplicate, and the data are presented as means ± standard deviations (n = 3).
6
Silkworm Genomic DNA and RNA Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
Bombyx mori (Dazao strain) larvae were reared on fresh mulberry leaves in a dedicated silkworm rearing room at ambient temperature (23–27 °C). Genomic DNA samples were separately isolated from virgin female and male individuals with tissue DNA kits (OMEGA, Norcross, GA). In the case of W contigs that had autosomal or Z paralogs, primers for genomic DNA PCR were designed considering the differences between the autosomal or Z paralogs and the W sequence at the 3’ end of the primer. PCR was performed with GO Taq DNA Polymerase (Promega, Madison, WI;Supplementary Table S1–S3 ), RNA was isolated from individual embryos following the traditional Trizol method (Ambion, Carlsbad, CA) using the total RNA isolation protocol according to the manufacturer’s instructions. Residual DNA in samples was used to identify the gender of each embryo with the W_seq1 marker (Supplementary Table S1 ). Total RNA (following DNase treatment) was subjected to reverse transcription using a PrimeScriptTM RT Master Mix (Perfect Real Time; TaKaRa, Kusatsu, Japan) in 50 μl reaction volume (2500 ng total RNA) and then diluted 5-fold. One μg of cDNA was used in 10 μl PCR reaction volume. Small RNAs (following DNase treatment) were subjected to reverse transcription using a Mir-X™ miRNA First-Strand Synthesis Kit (TaKaRa, Kusatsu, Japan). qPCR was performed with SYBR Premix Ex (TaKaRa, Kusatsu, Japan).
+ Expand
Bombyx mori (Dazao strain) larvae were reared on fresh mulberry leaves in a dedicated silkworm rearing room at ambient temperature (23–27 °C). Genomic DNA samples were separately isolated from virgin female and male individuals with tissue DNA kits (OMEGA, Norcross, GA). In the case of W contigs that had autosomal or Z paralogs, primers for genomic DNA PCR were designed considering the differences between the autosomal or Z paralogs and the W sequence at the 3’ end of the primer. PCR was performed with GO Taq DNA Polymerase (Promega, Madison, WI;
7
Quantifying m6A-Related Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of m6A-related genes METTL3, METTL14, FTO, WTAP, and ALKBH5 were detected by quantitative real-time PCR (RT-qPCR). Briefly, total RNA was isolated using TRIzol reagent (Invitrogen), and cDNA was generated by reverse transcription using Prime Script TMRT Master Mix (Perfect Real-Time; Takara Bio, Shiga, Japan). RT-PCR was performed using SYBR Green master mix (Yeasen, Shanghai, China) and a thermal cycler (LightCycler System; Roche Diagnostics Corp, IN, USA). β-Actin was used as an internal control to normalise the data. The primers used for RT-qPCR are presented in Table 2 .
8
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using a MiniBEST Universal RNA Extraction Kit (Takara, Shiga, Japan). Reverse transcription and real-time PCR (qRT-PCR) were performed with PrimeScriptTM RT Master Mix (Perfect Real Time, Takara) and SYBR® Premix Ex TaqTM II (Tli RNaseH Plus, Takara) following the manufacturer’s instructions. The gene-specific primers are shown in Supplementary Table S3 . The relative expression level of mRNA was examined as the inverse log of the delta CT and normalized to the reference gene, β-actin.
9
Drosophila Metabolic Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
Drosophila melanogaster w1118 was provided by Qidong Fungene Biotechnology (Jiangsu, China). Assay kits for glucose, triglyceride, and total protein were provided by Shenzhen Icubio Biomedical Technology Co., Ltd (Shenzhen, China). TRIzol reagent was purchased from Invitrogen (Carlsbad, CA, USA). PrimeScriptTM RT Master Mix (Perfect Real Time) was obtained from Takara Biomedical Technology Co., Ltd. (Dalian, China). TransStart Top Green qPCR SuperMix was purchased from TransGen Biotech (Beijing, China). Minimum essential medium (MEM), fetal bovine serum (FBS), MEM nonessential amino acids (100×), L‐glutamine (100×), and sodium pyruvate were provided by Gibco (Grand Island, NY, USA). Penicillin–streptomycin solution (100×) was obtained from Biosharp Life Sciences (Anhui, China). All other chemical reagents used in this study were of analytical grade.
+ Expand
Drosophila melanogaster w1118 was provided by Qidong Fungene Biotechnology (Jiangsu, China). Assay kits for glucose, triglyceride, and total protein were provided by Shenzhen Icubio Biomedical Technology Co., Ltd (Shenzhen, China). TRIzol reagent was purchased from Invitrogen (Carlsbad, CA, USA). PrimeScriptTM RT Master Mix (Perfect Real Time) was obtained from Takara Biomedical Technology Co., Ltd. (Dalian, China). TransStart Top Green qPCR SuperMix was purchased from TransGen Biotech (Beijing, China). Minimum essential medium (MEM), fetal bovine serum (FBS), MEM nonessential amino acids (100×), L‐glutamine (100×), and sodium pyruvate were provided by Gibco (Grand Island, NY, USA). Penicillin–streptomycin solution (100×) was obtained from Biosharp Life Sciences (Anhui, China). All other chemical reagents used in this study were of analytical grade.
10
Quantitative RT-PCR Analysis of Tobacco Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from WT tobacco tissue, such as leaves, roots, stems, buds and flowers, and from transgenic tobacco leaves according to the method described in Chen et al. (2017) (link). First-strand cDNA was synthesized using a PrimeScriptTM RT Master Mix (Perfect Real Time) (Takara, Clontech, Japan) according to the manufacturer’s instructions. The qRT-PCR was performed using SYBR® Premix Ex TaqTM (Tli RNaseH Plus) (Takara, Clontech, Japan), and primers listed in Supplementary Table S1 . The Tob103 gene (GenBank accession no. U60495) served as an internal control. The reaction mixtures consisted in 10 μl SYBR Green mix, 0.4 μl forward qRT-PCR primer, 0.4 μl reverse primer, 1 μl template cDNA, and 7.8 μl sterile water. The thermal cycling parameters were 95°C for 30 s, followed by 40 cycles of 95°C for 15 s and 58°C for 34 s. The relative expression levels were normalized to the expression of the Tob103 gene. The comparative cycle threshold (ΔΔCT) method was used to calculate the relative expression levels of the target genes. Data were expressed as the mean ± SD as determined from three independent biological replicates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!