Ab58552

Manufactured by Abcam

Sourced in United States

Ab58552 is a mouse monoclonal antibody that binds to an unspecified target. The core function of this product is to serve as a tool for research applications. No further details about the intended use or interpretation of this product are provided.

Automatically generated - may contain errors

Lab products found in correlation

Gapdh, by Cell Signaling Technology (1 mentions) Ab78486, by Abcam (1 mentions) Ab53104, by Abcam (1 mentions) Acetylcholine elisa kit, by Aviva Systems Biology (1 mentions) Ab85491, by Abcam (1 mentions) Ab5694, by Abcam (1 mentions) Ab129002, by Abcam (1 mentions) Ma3 925, by Thermo Fisher Scientific (1 mentions) A7811, by Merck Group (1 mentions) Ab59225, by Abcam (1 mentions) Ab2865, by Abcam (1 mentions) Ma3 919, by Thermo Fisher Scientific (1 mentions) P camkii thr286, by Cell Signaling Technology (1 mentions) Av41970, by Merck Group (1 mentions) Wheat germ agglutinin (wga), by Thermo Fisher Scientific (1 mentions) A21121, by Thermo Fisher Scientific (1 mentions) A27034, by Thermo Fisher Scientific (1 mentions) Ma3 916, by Thermo Fisher Scientific (1 mentions) Fluoromount g, by Electron Microscopy Sciences (1 mentions)

6 protocols using ab58552

Quantification of Acetylcholine and Signaling Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

The levels of acetylcholine (Ach) in serum were checked by ELISA using Acetylcholine ELISA Kit (OKEH02568; Aviva Systems Biology, San Diego, CA), following the manufacturer's manual. Protein levels of Aqp5, Cacna1c, Bdnf, and Nrg1 were detected by western blotting, following a standard protocol which is almost the same as indicated in our previous paper.¹¹ Antibodies used are as follows: Aqp5 (ab78486; Abcam, Cambridge, MA), Cacna1c (ab58552; Abcam), Bdnf (NB100‐98683; Novus Biologicals, Centennial, CO), and Nrg1 (ab53104; Abcam), Chrna1 (MA3‐043; Thermo Fisher, Waltham, MA), Gapdh (Cell Signaling Technologies, Danvers, MA).
Q‐PCR followed the standard protocol described before.¹¹ Primers used are as follows:
Chrna1Forward: 5′TCATCATTCCCTGCCTGCTCTTCT3′
Reverse: 5′TCTCTGCAATGTACTTCACGCCCT3′
Aqp5Forward Primer: AGAAGGAGGTGTGTTCAGTTGC
Reverse Primer: GCCAGAGTAATGGCCGGAT
Cacna1cForward Primer: ATGAAAACACGAGGATGTACGTT
Reverse Primer: ACTGACGGTAGAGATGGTTGC
BdnfForward Primer: TCATACTTCGGTTGCATGAAGG
Reverse Primer: AGACCTCTCGAACCTGCCC
Nrg1Forward Primer: ATGGAGATTTATCCCCCAGACA
Reverse Primer: GTTGAGGCACCCTCTGAGAC

Lin J., Lin N., Li X, & Kang M. (2022). Antagonist of Chrna1 prevents the pathogenesis of primary focal hyperhidrosis. Annals of Clinical and Translational Neurology, 9(6), 786-794.

+ Open protocol

+ Expand

Western Blot Analysis of Calcium Channels

Check if the same lab product or an alternative is used in the 5 most similar protocols

The right side of SN was digested by RIPA lysis buffer (50 mmol/L Tris-HCl; 150 mmol/L NaCl; 1% Nonidet; 0.5% deoxycholate; 1 mmol/L EDTA; and 1 mmol/L PMSF) with protease inhibitors (1 g/ml each of pepstatin, aprotinin and leupeptin) for 30 min. The protein concentration was determined by a BCA bicinchoninic acid kit. 30 μg of each protein sample was separated using 8% SDS-PAGE and transferred to PVDF membranes with a diameter of 0.45 μm. The PVDF membranes were blocked with 5% non-fat milk at 4°C overnight. The membranes were incubated with primary antibodies (ab58552, ab85491, ab5694; Abcam, Cambridge, UK), rabbit anti-mouse Cav1.2 antibody (1:200), mouse anti-mouse Cav1.3 antibody (1:500), rabbit anti-mouse β-actin antibody (1:15000) overnight at 4°C. After washed, the membranes were incubated with goat-anti rabbit and goat-anti mouse secondary antibodies conjugated with horseradish peroxidase (1:10000) at room temperature for 1 h. The antigen-antibody complexes were detected with enhanced chemiluminescence (ECL) reagent and visualized by Imager (UVP Biospectrum 810, USA).

Wang Q.M., Xu Y.Y., Liu S, & Ma Z.G. (2017). Isradipine attenuates MPTP-induced dopamine neuron degeneration by inhibiting up-regulation of L-type calcium channels and iron accumulation in the substantia nigra of mice. Oncotarget, 8(29), 47284-47295.

+ Open protocol

+ Expand

Protein Expression Analysis by Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein was isolated using RIPA buffer and ran in a 17-well Bolt™ 4–12% Bis-Tris Plus Gels containing 1X Bolt™ MOPS SDS Running Buffer. Precision Plus Protein™ Dual Color Standard was used as a protein ladder and gels run for 32 min at 200 V.
Gels were transferred using an iBlot™ 2 PVDF Transfer Stack in an iBlot 2 Dry Blotting System. Antibodies were 1:200 rabbit anti-CACNA1C (Abcam, ab58552), 1:10 000 rabbit anti-vinculin (Abcam, ab129002), 1:500 rabbit anti-RGS4 (Abcam, ab9964), 1:X rabbit anti-CACNB1 (Sigma, AV34953), 1:X rabbit anti-GNB1 (ThermoFisher Scientific, PA1-725), and 1:500 rabbit anti-GNG12 (ThermoFisher Scientific, PA5-75620). Anti-rabbit HRP secondary antibody (1:2000, Cell Signalling Technologies, 7074S) was used. Membranes were developed using Clarity™ Western ECL Blotting Substrates and imaged using a ChemiDoc imaging system. Images were analysed using ImageJ with vinculin as the loading control.

Couch L.S., Fiedler J., Chick G., Clayton R., Dries E., Wienecke L.M., Fu L., Fourre J., Pandey P., Derda A.A., Wang B.X., Jabbour R., Shanmuganathan M., Wright P., Lyon A.R., Terracciano C.M., Thum T, & Harding S.E. (2021). Circulating microRNAs predispose to takotsubo syndrome following high-dose adrenaline exposure. Cardiovascular Research, 118(7), 1758-1770.

+ Open protocol

+ Expand

Comprehensive Cardiac Protein Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following primary antibodies were used: mouse monoclonal antibodies to α-actinin [Western blotting (WB), 1:2500; immunofluorescence (IF), 1:400; A7811, Sigma-Aldrich], actin (WB, 300 ng/ml; A2171, Sigma-Aldrich), myomesin [WB/IF, 1:10; mMaC, Developmental Studies Hybridoma Bank (DSHB)], myosin (WB/IF, 1:10; MF20, DSHB), RyR2 (WB/IF, 1:1000; MA3-925, Thermo Fisher Scientific), SERCA2 (WB, 1:1000; IF, 1:100; MA3-919, Thermo Fisher Scientific), PLN [WB, 1:5000 (A010-14; Badrilla); WB, 2 μg/ml; IF, 1:200 (ab2865, Abcam)], titin (IF, 1:10; 9D10, DSHB), obscurin-NH₂ (WB/IF, 1:10; tissue culture supernatant) (13 (link)), and Hax-1 (WB, 1:1000; clone 52; 610824, BD Biosciences); rabbit monoclonal antibody to HSP90 (WB, 1:1000; 4877, Cell Signaling); and rabbit polyclonal antibodies to dihydropyridine receptor (WB/IF, 1:200; ab58552, Abcam), junctophilin-2 (WB, 1 μg/ml; 40-5300, Invitrogen), titin-Z (IF, 2 μg/ml) (44 (link)), SERCA2 (IF, 1:100; Ab91032, Abcam), sAnk1.5 (WB, 300 ng/ml; IF, 3 μg/ml) (9 (link)), SERCA2-pSer38 (WB, 1:1000; IF, 100; A010-25AP, Badrilla), RyR2-pSer2808 (WB, 1:2000; IF, 1:100; ab59225, Abcam), RyR2-pSer2814 (WB, 1:1000; A010-31AP, Badrilla), PLN-pSer16 (WB, 1:5000; A010-12, Badrilla), PLN-pSer16 (IF, 1:200; 07-052, Millipore), obscurin-COOH (WB, 300 ng/ml) (9 (link)), and obscurin-Ig58/59 (IF, 3 μg/ml) (45 (link)).

Hu L.Y., Ackermann M.A., Hecker P.A., Prosser B.L., King B., O’Connell K.A., Grogan A., Meyer L.C., Berndsen C.E., Wright N.T., Jonathan Lederer W, & Kontrogianni-Konstantopoulos A. (2017). Deregulated Ca2+ cycling underlies the development of arrhythmia and heart disease due to mutant obscurin. Science Advances, 3(6), e1603081.

+ Open protocol

+ Expand

Modulation of CaMKII and CACNA1C in Neurological Disorders

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary antibodies against CaM (SAB4503194, Sigma-Aldrich, St. Louis, MO, USA), CaMKII (4436, Cell Signaling Technology, Danvers, MA, USA), p-CaMKII (Thr286) (3361, Cell Signaling Technology), CACNA1C (ab58552, Abcam, Cambridge, MA, USA), BDNF (AV41970, Sigma-Aldrich), and tubulin (M2005, Abmart, Arlington, MA, USA) were used at dilution ratios recommended in the instruction manual. The secondary antibody, peroxidase-conjugated goat anti-rabbit antibody IgG (Santa Cruz Biotechnology, Dallas, TX, USA), was diluted at a dilution ratio of 1 : 2000.
The Shuyu capsules (clinical approval number 2011L06107), paeony extract (clinical approval number 20110527), and bupleurum extract (clinical approval number 20110526) used in the experiments were intragastrically administered to animals at doses of 0.41 g/kg/d, 0.32 g/kg/d, and 36 mg/kg/d, respectively, for 5 d. During modelling, all groups were given the drug once a day at 9:00 am at a dosage equivalent to 8 times the dosage administered to humans.
Paeoniflorin (Z110736) and nifedipine (N7634-1G) standards were purchased from Shanghai Yuanye Biotech (Shanghai, China) and Sigma-Aldrich, respectively. All other chemicals were obtained from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China).

Song C., Wang J., Gao D., Yu Y., Li F., Wei S., Sun P., Wang M, & Qiao M. (2017). Paeoniflorin, the Main Active Ingredient of Shuyu Capsule, Inhibits Cav1.2 and Regulates Calmodulin/Calmodulin-Dependent Protein Kinase II Signalling. BioMed Research International, 2017, 8459287.

+ Open protocol

+ Expand

Cryopreserved Cardiac Tissue Imaging

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were snap-frozen in optimal cutting temperature (OCT) compound (Sakura Finetek Europe B.V., Alphen aan den Rijn, Netherlands) and stored at −80°C until usage. Tissue sections of 100μm thickness were acquired with a cryotome (CM 1950, Leica AG, Wetzlar, Germany), immediately immersed in 1% paraformaldehyde for 15min and subsequently washed in PBS. RyRs were immunolabeled (MA3-916 and A-21121, ThermoFisher Scientific, Waltham, MA, USA), the sarcolemma and extracellular matrix stained with wheat germ agglutinin (WGA, ThermoFisher), and nuclei with DAPI as described previously.^{15 (link)} To stain L-type Ca channels, we used the same protocol on non-fixed tissue slices and applied rabbit anti-CACNA1C (1:200, ab58552, abcam) as primary and goat anti-rabbit conjugated to AF488 (1:400, A27034, ThermoFisher) as secondary antibodies. Tissue slices were mounted on a glass slide, embedded in Fluoromount-G (#17984-25, Electron Microscopy Science, Hatfield, PA, USA) and then dried for at least 24h at room temperature and <40% relative humidity.

Seidel T., Navankasattusas S., Ahmad A., Diakos N.A., Xu W.D., Tristani-Firouzi M., Bonios M.J., Taleb I., Li D.Y., Selzman C.H., Drakos S.G, & Sachse F.B. (2017). Sheet-Like Remodeling of the Transverse Tubular System in Human Heart Failure Impairs Excitation-Contraction Coupling and Functional Recovery by Mechanical Unloading. Circulation, 135(17), 1632-1645.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!