Targeted genes were amplified by a simplified version of the previously described PBRT technique [42 (link)]. Shortly, the eight Polymerase Chain Reaction (PCR) panels illustrated by Caratolli and colleagues [46 (link)], were reduced to three [42 (link)], (Table 6 ). PCR was performed using a readily reconstituted master mix according to manufacturer’s instructions (New England BioLabs, Inc. Beverly, MA) under the following conditions; 5 min at 94 °C; 30 cycles of 30 s at 94 °C, 30 s at 60 °C and 90 s at 72 °C; then a final extension of 5 min at 72 °C. Amplicons were visualised on 1.5% tris-acetate EDTA agarose gels alongside a 100 bp DNA ladder (New England BioLabs, Inc. Beverly, MA). The sample was considered positive for replicon gene (s) if an amplicon of the expected band size was observed.
Master mix
Manufactured by New England Biolabs
Sourced in United States
Master mix is a pre-formulated solution containing all the necessary components for a specific molecular biology reaction, such as enzymes, buffers, and reagents. It is designed to simplify and standardize the setup of these reactions, reducing the potential for errors and increasing consistency across experiments.
Automatically generated - may contain errors
Lab products found in correlation
Agarose gel, by Thermo Fisher Scientific (2 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (2 mentions)
Miniprep kit, by Qiagen (2 mentions)
100 bp dna ladder, by New England Biolabs (1 mentions)
Mycycler, by Bio-Rad (1 mentions)
Wizard genomic dna purification kit, by Promega (1 mentions)
Truseq dna pcr free kit, by Illumina (1 mentions)
Novaseq platform, by Illumina (1 mentions)
Gibson assembly, by New England Biolabs (1 mentions)
Forward and reverse primer, by Merck Group (1 mentions)
Nuclease free water, by Merck Group (1 mentions)
Molecular grade water, by Merck Group (1 mentions)
Epoch spectrophotometer, by Agilent Technologies (1 mentions)
Lightcycler 96 real time pcr machine, by Roche (1 mentions)
Dnase 1, by New England Biolabs (1 mentions)
Nuclease free water, by New England Biolabs (1 mentions)
Dna amplification machine, by Thermo Fisher Scientific (1 mentions)
Universal dna purification kit, by Tiangen Biotech (1 mentions)
Forward primer, by Eurofins (1 mentions)
Reverse primer, by Eurofins (1 mentions)
19 protocols using master mix
1
Simplified PCR Protocol for Replicon Detection
2
Validating miRNA Quantification Primers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The amplification was performed using optimisation and the universal stem-loop primer method.13 (link) In order to validate our primers for miRNA quantification listed in Table 1 , we test ran the primers against samples from known cervical cancer patients (as a positive control; n = 10) and patients with normal cervix (negative control; n = 10). The expression of oncomirs were at least fourfold higher in cancer patients than in healthy individuals while the expression of tumour suppressors were at least threefold higher in healthy individuals than in cancer patients. Template (complementary DNA, 2 µL), nuclease-free water (3 µL), forward primer (0.5 µL) and reverse primer (0.5 µL; Inqaba Biotechnical Industries Ltd, Hatfield, Pretoria, South Africa) and master mix (4 µL; New England Biolabs GmbH, Frankfurt, Germany) were added to each sample in no specific order. All reactions were done as singleplexes for each biomarker. Amplification conditions were: 94 °C pre-denaturation for 5 min, 94 °C for 30 s, annealing 55 °C for 30 s and extension 72 °C for 30 s and then 5 min at 72 °C by 45 cycles.
3
Genetic Analysis of t-PA Alu Polymorphism in Infertile Men
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from blood samples of control and infertile men using a commercial genomic DNA purification kit (Wizard Genomic DNA Purification Kit, Promega, USA).
DNA amplification by polymerase chain reaction (PCR) in a thermal cycler (MyCycler, Bio-Rad, USA) was performed following these conditions: initial denaturation for 2 min at 96°C, followed by 35 cycles of denaturation for 30 sec at 96°C, annealing for 30 sec at 65°C and elongation for 30 sec at 96°C. The total volume of each reaction was 30 µl containing 1 µl of each forward (GTAACCATTTAGTCCTCAGCTGTTCTCCT) and reverse (CCATGTAAGAGTAGAAGGAGACTCAG- TCA) primers (28), 8 µl of nuclease-free water, 15 µl of the master mix (New England Biolabs, USA), and 5 µl of DNA sample.
PCR products were separated on 2% agarose gel electrophoresis containing 0.5 µg/ml ethidium bromide. Homozygote individuals carrying the t-PA Alu inserts are designated Alu+ / + + / - - / -
DNA amplification by polymerase chain reaction (PCR) in a thermal cycler (MyCycler, Bio-Rad, USA) was performed following these conditions: initial denaturation for 2 min at 96°C, followed by 35 cycles of denaturation for 30 sec at 96°C, annealing for 30 sec at 65°C and elongation for 30 sec at 96°C. The total volume of each reaction was 30 µl containing 1 µl of each forward (GTAACCATTTAGTCCTCAGCTGTTCTCCT) and reverse (CCATGTAAGAGTAGAAGGAGACTCAG- TCA) primers (28), 8 µl of nuclease-free water, 15 µl of the master mix (New England Biolabs, USA), and 5 µl of DNA sample.
PCR products were separated on 2% agarose gel electrophoresis containing 0.5 µg/ml ethidium bromide. Homozygote individuals carrying the t-PA Alu inserts are designated Alu
4
16S rRNA Amplicon Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CTAB method was used to extract total genomic DNA, with the solution diluted to 1 ng/µl using sterile water. Using the diluted DNA as a template, universal primers (515F: 5′-GTGCCAGCMGCCGCGGTAA-3′; 806R: 5′-GGACTACHVGGG TWTCTAAT-3′; Sampson et al. 2016 (link), Snijders et al. 2016 (link)) were selected to target the V4 hypervariable region of 16S rRNA. Each sample was subjected to PCR in 30 µl of the reaction mixture, including 15 µl of Master Mix (New England Biolabs, MA), 0.2 µM of forward and reverse primers, and ca. 10 ng template DNA. The PCR conditions were as follows: initial denaturation at 98°C for 1 min followed by 30 cycles of 98°C (10 s), 50°C (30 s), and 72°C (30 s), and a post-PCR incubation at 72°C for 5 min. Samples containing bright main bands between 400 and 450 bp were retained for further experiments. The sequencing library was generated using the Truseq DNA PCR-Free kit (Illumina, CA), with an index code added. Library quality was evaluated using a Qubit 2.0 Fluorometer (Thermo Scientific, MA). Finally, the library was sequenced on the Illumina NovaSeq platform and 250-bp paired-end read segments were generated.
5
Cloning and Expression of Antibody Fragments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA in pComb3XSS phagemid was prepared from the ER2738 strain of E. coli bacteria for all ELISA-positive nAbs and the forward strand of the nAb insert subjected was sequenced using a primer (5’-TTAGGCACCCCAGGCTTTACACT-3’ ) that binds to the leader sequence of the pComb3XSS phagemid.
All unique ELISA-positive nAb sequences were amplified by PCR and ligated into the pEYFP-N1 or pEGFP-N1 mammalian expression plasmids as GFP fusions by Gibson Assembly, employing a commercial Master Mix (NEB Cat# E2611S) according to the manufacturer's protocol, and employing a SmaI (NEB Cat# R0141S) restriction site present in the pEYFP-N1 or pEGFP-N1 plasmid. The primers used for the Gibson assembly reaction were Forward:5’-ATTCTGCAGTCGACGGTACCGCGGGCCCTGGTTTCGCTACCGTGGCCCAGGCGGCC-3’ or 5'-CTTCGAATTCTGCAGTCGACGGTACCGCGGGGCCATGCAGKTGCAGCTCGTGGAGTC-3' ; Reverse: 5’-CTCACCATGGTGGCGACCGGTGGATCCCTAGCGTAGTCCGGAACGTCGTACGGGTA-3’ . Two independent colonies for each construct were selected for plasmid preparation, sequence determination and expression in mammalian cells. Plasmids encoding validated nAbs will be made publicly available in plasmid form from Addgene.
All unique ELISA-positive nAb sequences were amplified by PCR and ligated into the pEYFP-N1 or pEGFP-N1 mammalian expression plasmids as GFP fusions by Gibson Assembly, employing a commercial Master Mix (NEB Cat# E2611S) according to the manufacturer's protocol, and employing a SmaI (NEB Cat# R0141S) restriction site present in the pEYFP-N1 or pEGFP-N1 plasmid. The primers used for the Gibson assembly reaction were Forward:
6
Inactivation of cahI Gene in Streptomyces gandocaensis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cahI gene was inactivated by an insertional inactivation via double-crossover homologous recombination (Supplementary Fig. 7A ). A knock-out plasmid pSRP50 based on pKC1139 (ref. 60 (link)) was constructed by amplifying kanamycin resistance gene as a selection marker from plasmid pYJ276 (ref. 61 (link)), and left-and-right-flanking regions of the cahI gene using the genomic DNA of S. gandocaensis as a template. The primer pairs SR144-SR145, SR146-SR147 and SR148-SR149 (Supplementary Table 6 ) were designed for the amplification of left-and-right-flaking fragments of cahI gene, and selection marker, respectively. DNA assembly was performed using Gibson assembly62 (link) master mix (New England Biolabs) according to the manufacturer's instructions. The plasmid pSRP50 was passaged through methylation-deficient E. coli ET12567 and then introduced into the S. gandocaensis by protoplasts-based transformation63 (link). The target region of cahI gene was then disrupted by an insertional inactivation via double-crossover homologous recombination. The desired mutant ΔcahI was selected by its kanamycin-resistant and apramycin-sensitive phenotype (Supplementary Fig. 7b ) and verified by PCR (Supplementary Fig. 7c ) using the primer pair SR233–SR234 (Supplementary Table 6 ). The resulting cahI deletion mutant of S. gandocaensis was designated as DHS334.
7
Molecular Detection of Schistosome Infections
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Species-specific primers [9 ] were used (Table 2 ) to amplify cell-free repeat DNA fragments from filtered urine samples to confirm the presence of either S. mansoni or S. haematobium or both. For every reaction, three different controls were used: 1) S. mansoni and S. haematobium genomic DNA (BEI Resources, Manassas, VA, USA) as positive control; 2) extracted DNA from urine collected in-house as negative control; and 3) nuclease-free-water as water control (Sigma-Aldrich, St. Louis, MO, USA). A commercially purchased Mastermix (New England Biolabs, Ipswich, MA, USA), 10μM forward and reverse primers, magnesium, and nuclease-free-water (Sigma-Aldrich, St. Louis, MO, USA) was used for a 20μl PCR reaction. PCR amplification took place in an automated thermocycler with the following settings. For amplification of S. mansoni, the denaturation at 95°C for 10 minutes was followed by annealing process of 57°C for 90 seconds, which was repeated 35 times and ended with an extension at 72°C for 10 minutes. For the amplification of S. haematobium, the steps were same for denaturation expect that the annealing process was set at 56°C for 90 seconds and final extension of 72°C for 1 minute.
8
PCR Amplification of blaCTX-M Gene
9
Isothermal Amplification Assay Detection Methods
10
PCR Amplification of blaCTX-M Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following DNA extraction, Polymerase Chain Reaction (PCR) was performed on thermal cycler machine (BIO-RAD, T100™, Singapore) for all transconjugants samples to amplify blaCTX-M gene using specific primers (Table 1 ) as previously described [8 (link)]. Briefly, 2 μl of DNA samples were added into PCR tubes containing a readily reconstituted master-mix (New England Biolabs) to make a final volume of 25 μl reaction mixture. PCR conditions were: initial denaturation 95°C for 15 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 60°C for 40 seconds, and elongation at 72°C for 2 minutes. A final extension step followed at 72°C for 10 minutes. Finally, PCR products were detected in 1.5% agarose gel (Invitrogen from Fisher Scientific, UK), 90 Amp, 100V, for 45 minutes using TAE buffer and visualized under UV light.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!