Wild-type C57BL/6J mice (The Jackson Laboratory) and whole-body Gpd2−/− mice were maintained under specific pathogen-free conditions at the Harvard T.H. Chan School of Public Health in accordance with Institutional Animal Care and Use Committee (IACUC) guidelines. Male and female mice were used for in vivo LPS tolerance experiments and as a source of bone marrow for BMDM culture between 6 and 12 weeks of age. All protocols were approved by the IACUC of Harvard Medical School. In the in vivo LPS tolerance experiments, wild-type and Gpd2−/− mice were injected with vehicle (saline) or 3 mg/kg LPS via intraperitoneal injection (IP) followed by 30 mg/kg LPS IP 24h later. Serum IL-6 and internal body temperature (TH-5 Thermalert Clinical Monitoring Thermometer, Physitemp) were measured for 6 h after lethal LPS challenge. Survival of wild-type and Gpd2−/− mice that received both challenges was recorded as an indication of differential endotoxin tolerance in vivo.
Type c57bl 6j mice
Manufactured by Jackson ImmunoResearch
C57BL/6J mice are a widely used inbred mouse strain. They are a common model organism in biomedical research.
Automatically generated - may contain errors
Lab products found in correlation
Th 5 thermalert clinical monitoring thermometer, by Physitemp (2 mentions)
Cxcr2, by Jackson ImmunoResearch (2 mentions)
Megashortscript t7 kit, by Thermo Fisher Scientific (2 mentions)
Megaclear column, by Thermo Fisher Scientific (2 mentions)
Mmessage mmachine t7 ultra kit, by Thermo Fisher Scientific (2 mentions)
X tremegene hp, by Roche (2 mentions)
Rag2 γc, by Jackson ImmunoResearch (1 mentions)
Ifngr1fl fl, by Jackson ImmunoResearch (1 mentions)
Gfap cre, by Jackson ImmunoResearch (1 mentions)
Relafl fl, by Jackson ImmunoResearch (1 mentions)
Myd88fl fl, by Jackson ImmunoResearch (1 mentions)
Plp1 creert, by Jackson ImmunoResearch (1 mentions)
Stat3fl fl, by Jackson ImmunoResearch (1 mentions)
Cx3cr1 creert2, by Jackson ImmunoResearch (1 mentions)
Ccr2 gfp mice, by Jackson ImmunoResearch (1 mentions)
Cd45.2 ccr2 mice, by Jackson ImmunoResearch (1 mentions)
9 protocols using type c57bl 6j mice
1
In Vivo LPS Tolerance Assay
2
Conditional Knockout of Gch1 in Endothelial and Hematopoietic Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All animal procedures were approved and carried out in accordance with the University of Oxford ethical committee and the UK Home Office Animals (Scientific Procedures) Act 1986. All procedures conformed with the Directive 2010/63/EU of the European Parliament.
We have generated a Gch1 conditional knockout (floxed) allele using Cre/loxP strategy as described previously (Chuaiphichai et al., 2014 , McNeill et al., 2015 (link)). Gch1fl/fl animals were bred with Tie2cre transgenic mice to produce Gch1fl/flTie2cre mice where Gch1 is deleted in endothelial cells and bone marrow-derived cells. The Tie2cre transgene is active in the female germline. Consequently, only male animals are used to establish breeding pairs to maintain conditional expression. Experiments were performed using bone marrow isolated from 10-16 weeks old adult male and female Gch1fl/flTie2cre (referred to as Gchfl/flTie2cre) and their Gch1fl/fl (Gchfl/fl) littermates on a pure (> 10 generations) C57BL6/J background. Mice were genotyped according to the published protocol (Chuaiphichai et al., 2014 , McNeill et al., 2015 (link)). Nos2−/− (Nos2tm1Lau) (iNOS KO) and wild-type C57BL6/J mice were purchased from The Jackson Laboratory.
We have generated a Gch1 conditional knockout (floxed) allele using Cre/loxP strategy as described previously (Chuaiphichai et al., 2014 , McNeill et al., 2015 (link)). Gch1fl/fl animals were bred with Tie2cre transgenic mice to produce Gch1fl/flTie2cre mice where Gch1 is deleted in endothelial cells and bone marrow-derived cells. The Tie2cre transgene is active in the female germline. Consequently, only male animals are used to establish breeding pairs to maintain conditional expression. Experiments were performed using bone marrow isolated from 10-16 weeks old adult male and female Gch1fl/flTie2cre (referred to as Gchfl/flTie2cre) and their Gch1fl/fl (Gchfl/fl) littermates on a pure (> 10 generations) C57BL6/J background. Mice were genotyped according to the published protocol (Chuaiphichai et al., 2014 , McNeill et al., 2015 (link)). Nos2−/− (Nos2tm1Lau) (iNOS KO) and wild-type C57BL6/J mice were purchased from The Jackson Laboratory.
3
Genetically Deficient Mice for Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice genetically deficient in all β2 integrins
(CD18−/−),
CXCR2 (CXCR2−/−),
or in γδTCR
(Tcrδ−/−) were
purchased from the Jackson Laboratories. These mice were crossed with
wild-type C57BL/6J mice (Jackson Laboratories) to generate gene-deficient
(homozygotes and heterozygotes) mice and wild-type littermate controls for
use in experiments. Mice deficient in both CD18 and γδTCR
(CD18−/−/γδT−/−)
were generated by breeding the two parental knockout mouse strains. Groups
of mice within the same experiment were sex- and age-matched. Male or female
mice were used in infection experiments with C. rodentiumat the age of 8 weeks. As there were no significant differences in the
results obtained with males and females (e.g., CD18
deficiency resulted in similar susceptibility to infection regardless of
sex), their respective data were pooled. All animal procedures were
performed according to protocols reviewed and approved by the Institutional
Animal Care and Use Committee of the University of Pennsylvania.
(CD18−/−),
CXCR2 (CXCR2−/−),
or in γδTCR
(Tcrδ−/−) were
purchased from the Jackson Laboratories. These mice were crossed with
wild-type C57BL/6J mice (Jackson Laboratories) to generate gene-deficient
(homozygotes and heterozygotes) mice and wild-type littermate controls for
use in experiments. Mice deficient in both CD18 and γδTCR
(CD18−/−/γδT−/−)
were generated by breeding the two parental knockout mouse strains. Groups
of mice within the same experiment were sex- and age-matched. Male or female
mice were used in infection experiments with C. rodentiumat the age of 8 weeks. As there were no significant differences in the
results obtained with males and females (e.g., CD18
deficiency resulted in similar susceptibility to infection regardless of
sex), their respective data were pooled. All animal procedures were
performed according to protocols reviewed and approved by the Institutional
Animal Care and Use Committee of the University of Pennsylvania.
4
Generation of Slc12a8 Knockout Mouse Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-body Slc12a8 knockout (Slc12a8KO) mice were generated with the CRISPR-CAS9 technology by the Transgenic Vectors Core of Washington University. CRISPR gRNAs were designed to flank exon 4 of the Slc12a8 gene. gRNA sequences were as follows: 5’ gRNA; 5’- agtgcatgtatagacgtatg - 3’ and 3’ gRNA; 5’ - cctcacaaatatttacaggc - 3’. gRNAs were obtained as gBlocks (IDT). Cleavage activity was assessed by transfecting N2A cells with gBlock and Cas9 plasmid (addgene # 42230) using XtremegeneHP (Roche). Cleavage activity was determined by T7E1 assay using standard methods. gRNA was in vitro transcribed using the T7 Megashort Script Kit (Ambion). Cas9 RNA was in vitro transcribed using the mMessage mMachine T7 Ultra Kit (Ambion). All RNA was purified using Megaclear Columns (Ambion). RNA was microinjected into C57BL/6J × CBA hybrid zygotes at a concentration of 50 ng/μl Cas9, 25 ng/μl gRNA, and 100 ng/μl ssODN in the Washington University Mouse Genetic Core Facility. Whole-body knockout alleles were detected by PCR across the cleavage site and confirmed by sequencing. One heterozygous founder was established, and the mice were backcrossed to wild-type C57BL/6J mice (Jackson Laboratories) for 5 generations before analysis. Slc12a8-deficient heterozygous mice were crossed to generate homozygous Slc12a8KO mice. Wild-type littermates were used as controls.
5
Genetically Deficient Mice for Infection
6
Murine Models for Cancer Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type C57BL/6J mice and breeding pairs of ApcMin/+, Gfap-tk (thymidine kinase), Gfap-Cre, Plp1-CreERT, inducible diphtheria toxin receptor (iDTR), Rag2-/- γc-/-, Myd88fl/fl, Ifngr1fl/fl, Relafl/fl, and Stat3fl/fl mice were purchased from The Jackson Laboratory. All mice were housed in an American Association for the Accreditation of Laboratory Animal Care-accredited animal facility and maintained in specific pathogen-free conditions on wood-chip bedding and fed standard rodent chow ad libitum unless otherwise stated. Littermates were used for controls whenever possible; if different litters had to be combined, mice were age matched and non-littermates were co-housed to eliminate effects of the microbiome. Mice of both sexes were utilized in the experiments performed in this study, and experiments were carried out during the light cycle. All animal care and experimentation were approved by the Stanford University Institutional Animal Care and Use Committee.
7
In Vivo LPS Tolerance Assay
8
Generation of Slc12a8 Knockout Mouse Model
9
Parabiosis Experiments with Ccr2 Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type C57BL/6J mice (Jackson Laboratory, #000664) and CCR2 GFP/+ mice (Jackson Laboratory, #027619) of various ages were used for this study. Rosa Td reporter mice (Jackson Laboratory, #007914) were crossed with Cx3cr1 CreERT2 (Jackson Laboratory, #020940) or Ccr2 CreERT2 mice, a gift from B. Becher. Parabiosis experiments used CD45.2 Ccr2 +/+ mice (Jackson Laboratory, #000664), CD45.2 Ccr2 -/-mice (Jackson Laboratory, #004999), and CD45.1 Ccr2 +/+ mice (Jackson Laboratory, #002014). All mice were bred in our animal facility at the University Health Network. All protocols were approved by the Animal Resource Centre, University Health Network (AUP#4054), Toronto, Ontario, Canada.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!