Sensifast probe no rox one step kit

iPS-Mϕ were lysed in BL buffer at 24h.p.i. ZIKV^FP MOI=10, iPS-MGL were lysed in BL buffer at 24h.p.i. ZIKV^FP MOI=1. T otal RNA was extracted using the ReliaPrepTM RNA Cell Miniprep System (Promega, USA) and treated with DNase I according to the manufacturer’s instructions. Quantity of purified RNA was measured spectrophotometrically (A260/A280) using a NanoDrop One^C Microvolume UV-Vis Spectrophotometer (Thermo Fisher, MA, USA). RT-PCR was performed using the SensiFAST™ Probe No-ROX One-Step Kit (Bioline, USA) with AriaMx Real-time PCR System (Agilent Technologies, CA, USA) according to manufacturer’s instructions. The following TaqMan gene expression assay (Thermo Fisher) was used: IFNA1 (Hs03044218_g1). The primers were designed using the Roche Universal ProbeLibrary Assay Design tool (Roche, Basel, Switzerland) with the indicated UPL probes. Further details, including additional primer/probe information, are summarised in Table S1. Target gene expression was normalised to the housekeeper GAPDH or 18S as indicated. Each sample was run in technical duplicate. Cycling conditions were as follows: reverse transcription at 50°C for 15 min, followed by initial polymerase activation at 95°C for 10 min, and then 40 cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 1 min.

To measure the viral loads of SARS-CoV-2 and MERS-CoV in the lung tissues and swab samples, quantitative real-time PCR was performed to detect the N gene of SARS-CoV-2 using a TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and the S2 gene of MERS-CoV using a SensiFAST™ Probe No-ROX One-Step Kit (Bioline, London, UK), as previously described [13 (link),14 (link)]. One gram of lung tissue samples from all of the dogs was placed into soft tissue homogenizing CK14 tubes (Precellys, Betin Technologies, Montigny-le-Bretonneux, France) prefilled with ceramic beads and DMEM, and then homogenized using a Bead Blaster 24 (Benchmark Scientific, Sayreville, NJ, USA). The swabs were placed in 1 mL DMEM supplemented with antibiotics and suspended by vortexing. The viral RNA was extracted from the swab samples and the homogenized tissues using a QIAamp viral RNA Mini Kit (Qiagen, Redwood, CA, USA), according to the manufacturer’s protocol. Real-time PCR for each virus was conducted using a CFX96 Touch real-time PCR detection system (Bio-Rad, Hercules, CA, USA).

Viral RNA was purified using a QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany), following the manufacturer’s instructions, and samples were stored at -80 °C until further analysis. Viral RNA from SARS-CoV-2 was extracted from 200 μL of culture supernatant in a BL-3 containment facility at KRIBB, and all RT-qPCR assays were conducted in BL-2 facilities at KRIBB. RT-qPCR assays were performed using a LightCycler 96 instrument and analysis software (Roche, Switzerland). We used a SensiFAST Probe No-ROX One-Step Kit (Bioline, UK) for the one-step RT-qPCR assays according to the manufacturer’s guidelines. Briefly, the reaction mixture contained 5 μL RNA template, 0.2 μL of reverse transcriptase, 0.4 μL of RNase inhibitor for cDNA synthesis, 10 μL of 2× reaction buffer with Taq polymerase, 1 μL of each primer (10 µM), 1 μL of each probe (5 μM), and RNase-free water to a final volume of 20 μL. The PCR cycling conditions were as follows: initial incubation at 45 °C for 15 min and 95 °C for 10 min for the reverse transcription step, followed by 40 cycles at 95 °C for 5 s and 58 °C for 30 s.

RNA was extracted from supernatant culture media using the QIAamp 96 Virus QIAcube HT Kit (Qiagen). E-gene expression was determined using the SensiFAST Probe No-Rox One Step Kit (Bioline) and the following primers/probes: Fwd: 5′-ACAGGTACGTTAATAGTTAATAGCGT-3′, Rev: ATATTGCAGCAGTACGCACACA and Probe: FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ. Viral genome copies were interpolated using a standard curve generated by using a plasmid vector containing the E-gene.

RNA was extracted from supernatants using the QIAamp Viral RNA Mini Kit (Qiagen, NRW, Hilden, Germany). To prevent the inhibitory effect of heparin during RT-PCR, extracted RNA (8 μL) was treated with 0.5 units of Heparinase I (Sigma-Aldrich, diluted in 20 mM Tris, 600 mM NaCl, 150 mM CaCl₂, pH 7.0) and 40 units of RNAseOUT (Thermo Fisher Scientific) for 1 h at room temperature. Treated RNA was assessed for E-gene levels using the SensiFAST Probe No-Rox One Step Kit (Bioline, London, UK) and the following primers/probes: Fwd: 5′-ACAGGTACGTTAATAGTTAATAGCGT’-3, Rev: ATATTGCAGCAGTACGCACACA and Probe: FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ. Viral genomes were interpolated using a standard curve generated by a plasmid containing the E-gene.

To analyze the gene expression, the cells (0.5 × 10⁵) were seeded in 6-well plates and incubated with 1-µM etoposide and/or 10–50-µg/mL kaempferol, P2, P5, and P7 at 37 °C for 24 h. Afterwards, the cells were collected, and the total RNA from each sample was extracted using the Universal RNA Purification Kit (EurX, Gdansk, Poland), according to the manufacturer’s instructions. Reverse transcription and real-time PCR reactions were performed using the SensiFAST™ Probe No-ROX One-Step Kit (Bioline, London, UK) on the CFX96 C1000 real-time system (Bio-Rad, Hercules, CA, USA). The relative expression was evaluated using the TaqMan gene expression assay for HO-1: Hs00157965_m1, NFE2L2: Hs00975961_m1, NQO1: Hs00168547_m1, SOD1: Hs00533490_m1, SOD2: Hs00167309_m1, and GAPDH: Hs02786624_m1 (Thermo Fisher Scientific, Waltham, MA, USA). The GAPDH gene was utilized as a reference gene. Each assay was performed in quadruplicate. The relative gene expression was calculated as the fold change according to the control sample based on the double-delta Ct method.