Ab47300

Manufactured by Abcam

Sourced in United States

Ab47300 is a primary antibody for use in various immunological techniques. The antibody targets a specific antigen and can be used to detect and study the presence or distribution of the target molecule in biological samples.

Automatically generated - may contain errors

Lab products found in correlation

4 protocols using ab47300

Western Blot Analysis of Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells or tissues were added with 50 μL radio-immunoprecipitation assay (RIPA) lysis buffer (containing protease inhibitor) (P0013J, Beyotime, Shanghai, China) and protein was gained and quantified by utilization of the bicinchoninic acid (BCA) kit (PC0020, Solarbio). Later, 50 μg of protein was subjected to electrophoresis, and then transferred to nitrocellulose membranes (66485, Pall Corp, East Hills, NY). The membrane was sealed in 5% skimmed milk powder at ambient temperature for 2 h and probed with primary antibodies against KIF3A (ab11259, 1:2000, Abcam), p21 (ab109520, 1:1000, Abcam), p-p21 (ab47300, 1:1000, Abcam), Bax (ab32503, 1:1000, Abcam), Bcl-2 (#4223, 1:1000, Cell Signaling Technology [CST]), Cle-caspase 3 (ab32042, 1:500, Abcam), CD63 (ab134045, 1:1000, Abcam), CD81 (#56039, 1:1000, CST), Hsp70 (#4876, 1:1000, CST), Calreticulin (ab92516, 1:1000, Abcam) and β-actin (#4970, 1:1000, CST) overnight at 4 °C. The next day, the membrane was further incubated with horseradish peroxidase (HRP)-labeled secondary antibody goat anti-rabbit IgG (ab6721, 1:2000, Abcam) at ambient temperature for 1 h. Afterwards, the membrane was visualized by ECL reagent (BM101, Biomiga Inc), and then BioSpectrum 600 imaging system (Ultra-Violet Products, UK) was processed for detection and analysis. β-actin was used as normalizer.

Xiang Y., Lv D., Song T., Niu C, & Wang Y. (2022). Tumor suppressive role of microRNA-139-5p in bone marrow mesenchymal stem cells-derived extracellular vesicles in bladder cancer through regulation of the KIF3A/p21 axis. Cell Death & Disease, 13(7), 599.

+ Open protocol

+ Expand

Western Blot Analysis of Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total protein was isolated using the Radioimmunoprecipitation Assay Kit (R0010, Beijing Solabio Life Sciences, Beijing, China). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis kit was used to prepare 10% separation gel and 5% concentrating gel samples. After electrophoresis, the protein was transferred onto a nitrocellulose membrane. The membrane was incubated with the following primary antibodies overnight at 4°C: rabbit polyclonal antibody to TPX2 (ab71816, 1:100, Abcam), p53 (ab32049, 1:1,000, Abcam), p21 (ab47300, 1:500, Abcam), MDM2 (ab38618, 1:1,000, Abcam), bax (ab53154, 1:500, Abcam), bcl-2 (ab59348, 1:1,000, Abcam), and PCNA (ab152112, 1:500, Abcam). The membrane was rinsed three times using Tris-buffered saline containing Tween 20 on the following day. The secondary rabbit polyclonal antibody (ab7312, Abcam) was added and incubated for 1 h. Developer (D-90G, Shanghai Yingdian Detection Equipment, Shanghai, China) was added, and images were acquired using the Bio-Rad gel imaging system (Beijing Thmoregan Biological Technology, Beijing, China). IPP7.0 software (Media Cybernetics, Bethesda, MD, USA) was adopted for quantitative analysis.

Feng C., Zhang H.L., Zeng A., Bai M, & Wang X.J. (2020). Tumor-Suppressive MicroRNA-216b Binds to TPX2, Activating the p53 Signaling in Human Cutaneous Squamous Cell Carcinoma. Molecular Therapy. Nucleic Acids, 20, 186-195.

+ Open protocol

+ Expand

Evaluation of EMT and Cell Cycle Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-DAPL1 (ab150969), anti-P-Cadherin (ab242060), anti-ZEB1 (ab87280) and anti-p-P21 (ab47300) were purchased from Abcam. Anti-ZO-1 (8193T), anti- E-Cadherin (3195S) anti-N-cadherin (13116T), anti-vimentin (5741T), anti-SNAIL (3879T), anti-αSMA (19245S), anti-P-smad2/3 (8828S), anti-P21 (2947S) and anti- NFκB (RelA) (4764s) were obtained from Cell Signaling Technology. The anti-GAPDH (KC-5G4) antibody was purchased from Aksomics. The anti-OTX2 (AF1979) antibody was purchased from R&D systems. The anti-p-P38 MAPK (AM063) antibody was purchased from Beyotime China. Primer sequences for real-time PCR were as follows: DAPL1-F, GAAAGCTGGAGGGATGCGAA; DAPL1-R, TGATGTCCGTGTGAACTGT; GAPDH-F, AGGTCGGTGTGAACGGATTTG; GAPDH-R, TGTAGACCATGTAGTTGAGGTCA; P21-F, AGTCAGTTCCTTGTGGAGCC; P21-R, CATTAGCGCATCACAGTCGC.

Ma X., Han S., Liu Y., Chen Y., Li P., Liu X., Chang L., Chen Y.A., Chen F., Hou Q, & Hou L. (2023). DAPL1 prevents epithelial–mesenchymal transition in the retinal pigment epithelium and experimental proliferative vitreoretinopathy. Cell Death & Disease, 14(2), 158.

+ Open protocol

+ Expand

Quantitative Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

To evaluate protein expression, cells were harvested in RIPA buffer containing a protease inhibitor cocktail, and total protein was quantified using a bicinchoninic acid kit (Pierce, Rockford, IL, USA). Aliquots containing 8 μg total protein were separated by sodium dodecyl sulphate polyacrylamide gel electrophoresis and then electroblotted onto a 0.45-μm PV membrane (Immobilon™; Merck Millipore, Darmstadt, Germany). The membranes were blocked and then probed overnight with the primary antibodies anti-SCD1 (1:1000, #ab19862; Abcam, USA), anti-CDKN1A (1:10,000, #ab47300; Abcam, USA), anti-FOS (1:500, #ab184666; Abcam, USA), anti-EXO1 (1:2000, #ab95068; Abcam, USA), anti-PLS1 (1:2000, #ab236976; Abcam, USA), anti–β-catenin (1:5000, #ab32572; Abcam, USA), and anti–active β-catenin (1:500, #05-665; Merck Millipore). Results are expressed as means ± standard deviations of six independent experiments.

Chen Y.S., Kang X.R., Zhou Z.H., Yang J., Xin Q., Ying C.T., Zhang Y.P, & Tao J. (2020). MiR-1908/EXO1 and MiR-203a/FOS, regulated by scd1, are associated with fracture risk and bone health in postmenopausal diabetic women. Aging (Albany NY), 12(10), 9549-9584.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!