Human PTC cell lines (TPC-1 and KTC-1) were obtained from Procell (Wuhan, China). The human thyroid follicular epithelial cell line (Nthy-ori3-1) was obtained from the American Type Culture Collection (Manassas, VA, USA). Dulbecco’s modified Eagle’s medium (DMEM) mixed with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 µg/mL streptomycin was utilized for cell culture [15 (link)]. Cells were incubated at 37°C in a humidified atmosphere of 5% CO2.
Tpc 1
Manufactured by Procell
Sourced in China
The TPC-1 is a laboratory instrument designed for the analysis and testing of materials. It is capable of performing thermal analysis, calorimetry, and other related measurements. The core function of the TPC-1 is to provide accurate and reliable data about the thermal properties of samples, enabling researchers and scientists to investigate and understand the behavior of various materials.
Automatically generated - may contain errors
Lab products found in correlation
Bcpap, by Procell (7 mentions)
Nthy ori 3 1, by Procell (6 mentions)
Ktc 1, by Procell (2 mentions)
Ftc 133, by Procell (2 mentions)
Rpmi 1640 medium, by Solarbio (2 mentions)
Dmem medium, by Thermo Fisher Scientific (2 mentions)
Tpc 1, by Merck Group (2 mentions)
Rpmi 1640 medium, by Merck Group (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Nthy ori 3 1, by American Type Culture Collection (1 mentions)
Rpmi 1640, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Actinomycin d, by Merck Group (1 mentions)
Sw579, by Procell (1 mentions)
Penicillin streptomycin, by Solarbio (1 mentions)
Fetal bovine serum (fbs), by Cellmax (1 mentions)
Penicillin, by Solarbio (1 mentions)
Streptomycin, by Solarbio (1 mentions)
Khm 5m, by National Collection of Authenticated Cell Cultures (1 mentions)
Cal 62, by National Collection of Authenticated Cell Cultures (1 mentions)
13 protocols using tpc 1
1
Culturing Human Thyroid Cell Lines
2
Cell Line Treatments and Transfections
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Normal human thyroid (Nthy-ori 3–1) and PTC (TPC-1 and B-CPAP) cell lines were purchased from Procell (Wuhan, China). The cells were cultured in a standard incubator at 37°C with 5% CO2 in RPMI-1640 (Gibco; Thermo Fisher Scientific, Waltham, MA, USA) with 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin [20 (link)]. The cells were treated with actinomycin D (2 μg/mL; Sigma-Aldrich, St. Louis, MO, USA) to analyze the mRNA stability. pcDNA3.1-SLC8A1-AS1, SLC8A1-AS1 small interfering (si) RNA, FUS siRNA, Numbl siRNA, and their corresponding negative controls (GenePharma, Shanghai, China) were transiently transfected into PTC cell lines using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C for 48 h, according to the manufacturer’s instructions.
3
Thyroid Cancer Cell Line Cultivation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human papillary thyroid cancer cell lines (TPC-1, BCPAP), a human squamous thyroid cancer cell line (SW579), and a human follicular thyroid cancer cell line (FTC-133) were purchased from Procell Life Science & Technology Co., Ltd. (Wuhan, China). A normal human thyroid cell line (Nthy-ori 3–1) was purchased from Jennio-Bio Co., Ltd. (Guangzhou, China). All cells were cultured in RPMI 1640 medium (Solarbio, Beijing, China) supplemented with 10% v/v foetal bovine serum (FBS, Gemini) and 1% v/v penicillin/streptomycin (Solarbio) in an atmosphere containing 5% CO2 at 37°C. All cell lines used in our experiments have been checked by STR profiling, tested for mycoplasma contamination, and cultured at low passage.
4
Cell Culture Conditions for Thyroid Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human PTC cell lines BCPAP and TPC1 and the normal human thyroid cell line Nthy-ori 3–1 (hereafter abbreviated as Nthy) (Procell Life Science & Technology Co, Ltd, Wuhan, China) were maintained in RPMI 1640 medium (Solarbio, Beijing, China) supplemented with 10% fetal bovine serum (Cellmax, Beijing, China), 100 U/mL penicillin, and 0.1 mg/mL streptomycin (Solarbio) at 37 °C with 5% CO2.
5
Culturing Thyroid Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human thyroid epithelial cell line Nthy-ori 3-1 (NTHY), PTC cell lines TPC-1, BCPAP, and IHH4 were acquired from Procell Life Science & Technology (Wuhan, China). The human ATC cell lines KHM-5M, C643, CAL-62 and BHT101 were acquired from the National Collection of Authenticated Cell Cultures (Shanghai, China). Deutsche Sammlung von Mikroorganismen und Zellkulturen provided us with another ATC cell line called 8505C. All cells have STR Authentication and were cultured in HyClone RPMI-1640 with 10% fetal bovine serum (Cat: S-FBS-SA-015, SERANA, Germany), 100U/ml penicillin, and 0.1 mg/ml streptomycin. The cells were maintained at 37 °C with 5% CO2.
6
Thyroid Cancer Cell Lines and Tissue Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
THCA cell lines (TPC-1 and BCPAP) and normal cells of human thyroid gland (Nthy-ori 3-1) were purchased from Procell and cultured with Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and Pen-Strep. THCA tissue specimens were collected from Fujian Medical University Cancer Hospital. All the experiments were directed by manipulation instruction and approved by Clinical Oncology School of Fujian Medical University, Fujian Cancer Hospital (Approval No. SQ2018-108).
7
Culture of Human Thyroid Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human PTC cell lines (BCPAP and TPC-1) were purchased from Procell Life Science (Wuhan, China) with STR profiles. All cells were cultured in DMEM medium (Gibco) supplemented with 10 % fetal bovine serum (FBS) (Gibco) and 1 % penicillin/streptomycin (Gibco) at 37 °C with 5 % of CO2.
8
Culturing Thyroid Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human thyroid follicular epithelial cell line Nthy‐ori 3‐1 (EK‐Bioscience) and human thyroid cancer cells (TPC‐1, KTC‐1, 8305C, FTC‐133, and CAL‐62; Procell) were cultured in Roswell Park Memorial Institute (RPMI)‐1640 medium supplemented 10% fetal bovine serum(FBS), 100 U/mL penicillin/streptomycin, and 100 U/mL glutamine (Procell) under 5% CO2 and 37°C.
9
Silencing eEF1A2 in PTC Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human PTC cell lines TPC-1 and BCPAP were obtained from Procell Life Science and Technology Co., Ltd. (RRID: CL-0643 CL-0575, 1 × 106, Wuhan, China). All cells were cultured in RPMI 1640 medium (ProCell) supplemented with 10 % foetal bovine serum (FBS, ProCell, South America). 3.75 μL of Lipofectamine™3000 reagent (Invitrogen™, USA) and 250 pmol siRNA were separately added to 125 μL of serum-free, high glucose DMEM (Procell) media, and mixed gently. Finally, the mixed solution was added to the cells cultured in 1000 μL fresh RPMI 1640 medium with 10 % FBS after 15 min incubation at room temperature. The follow-up experiments was initiated with Si-eEF1A2 PTC cells and Si-CTR PTC cells and were performed after the cells were cultured for 48–72 h EEF1A2-siRNA target sequences (5′–3′) No 1: GCGACUUCAUCAAGAACAUGA and No 2: CAUCAAGAAGAUCGGCUACAA.
10
Culturing Thyroid Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human normal thyroid epithelial cell line N-thy-ori-3-1 and the thyroid cancer cell lines FTC-133 and TPC-1 were obtained from Procell (Wuhan, China). All cell lines were cultured in DMEM (Irvine Scientific, Carlsbad, CA) supplemented with 10% foetal bovine serum (FBS).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!