PCR was performed on genomic DNA using an AccuPower HotStart PCR Premix (Bioneer, Daejeon, Korea) and specific primers [11 (link)] (forward: 5′-FAM- TGCCTATTCCTAACTGACTCATCA--3′, reverse:5′- TCTTTGTTGCTGTCCTTCCA − 3′) to amplify FLT3 exon 14 and 15 regions with following conditions: 94 °C for 5 min followed by 35 cycles of 94 °C for 30 s, 60 °C for 30 s and 72 °C for 60 s, and final extension at 72 °C for 7 min. Thereafter, 10 μL of the mixture of 0.5 μL fragment-length standard (GeneScan-600 LIZ Size Standard, Thermo Fisher Scientific, Foster City CA, USA) and 10 μL HiDi formamide (Thermo Fisher Scientific) was added to 1 μL of 30 times diluted PCR product. After the initial denaturation of this mixture at 95 °C, size-separation by capillary electrophoresis was performed on a 3130 Genetic Analyzer (Thermo Fisher Scientific) using the separation matrix POP-7 polymer (Thermo Fisher Scientific). Data analysis was performed using the GeneMapper version 3.2 software program (Thermo Fisher Scientific). The FLT3 ITD allelic ratio (AR) is calculated as the ratio of the peak height of the mutant product to the peak height of the wild-type product. The detection limit of PCR-based capillary electrophoresis fragment analysis used in this study was AR of 0.01. A manual review of the FLT3 ITD region was performed in all cases.
Genescan 600 liz size standard
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom
The GeneScan 600 LIZ Size Standard is a molecular weight size standard used in DNA fragment analysis. It contains a mixture of DNA fragments of known sizes, which are labeled with a fluorescent dye (LIZ) for detection during capillary electrophoresis. This size standard is designed to be used as a reference to accurately determine the size of unknown DNA fragments in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Hi di formamide, by Thermo Fisher Scientific (8 mentions)
3500 genetic analyzer, by Thermo Fisher Scientific (4 mentions)
Abi prism 3130xl genetic analyzer, by Thermo Fisher Scientific (3 mentions)
3130 genetic analyzer, by Thermo Fisher Scientific (3 mentions)
Flexigene kit, by Qiagen (2 mentions)
Genemaker software v2, by SoftGenetics (2 mentions)
P388 a2 salsa mlpa kit, by MRC-Holland (2 mentions)
Abi prism 3130 genetic analyzer, by Thermo Fisher Scientific (2 mentions)
Genemapper software, by Thermo Fisher Scientific (2 mentions)
T professional basic gradient thermal cycler, by Analytik Jena (2 mentions)
Peak scanner v1, by Thermo Fisher Scientific (2 mentions)
Pop7 polymer, by Thermo Fisher Scientific (1 mentions)
Accupower hotstart pcr premix, by Bioneer (1 mentions)
Abi 3500 analyzer, by Thermo Fisher Scientific (1 mentions)
Abi 3730 dna analyzer, by Thermo Fisher Scientific (1 mentions)
Applied biosystems 3730xl dna analyzer, by Thermo Fisher Scientific (1 mentions)
Primestar max premix, by Takara Bio (1 mentions)
Peak scanner 2, by Thermo Fisher Scientific (1 mentions)
Globalfiler, by Thermo Fisher Scientific (1 mentions)
Genemapper id x v1, by Thermo Fisher Scientific (1 mentions)
25 protocols using genescan 600 liz size standard
1
Quantitative FLT3 Mutation Profiling
2
Methylation Sensitive AFLP Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Methylation Sensitive Amplified Length Polymorphism (MSAP) method, a modified version of the Amplified Fragment Length Polymorphism (AFLP) DNA fingerprinting technique [37 (link)], was adapted from [26 (link)]. Briefly, we initially tested 32 primer combinations on a subset of 16 samples using two sets of restriction and ligation reactions. Seven combinations of EcoRI (labelled primers) / HpaII—MspI primers (S4 Table ) were selected for the MSAP analysis of the total 54 samples, based on clarity and reproducibility of amplified bands and the presence of polymorphism. Eleven samples were replicated, starting from the same leaf sample and two different DNA-extractions to assess reproducibility. PCR amplicons were fluorescently labeled with one of two dyes: NED and VIC, and were run in simplex on an ABI 3500 analyzer with the GeneScan-600 LIZ size standard (Thermo Fisher Scientific). The EcoRI—MspI and EcoRI—HpaII DNA fingerprinting profiles were processed per primer combination. Only fragments ≥150 bp in size were considered to reduce the potential impact of size homoplasie [38 ]. The genotyping error rate was estimated for each primer combination according to [39 (link)] and based on the 11 replicates.
3
RNASEH2B Gene Deletion Detection in CLL
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from primary CLL cells using the Flexigene kit (Qiagen). To identify deletions in RNASEH2B gene the MLPA assay was performed on approximately 100 ng of genomic DNA (gDNA) per sample using the P388-A2 SALSA MLPA kit (MRC-Holland) according to the manufacturer’s protocol. 2 µl of amplified products were separated by capillary electrophoresis on an ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems) with a GeneScan 600 LIZ Size Standard (Thermo Fisher). Data were analyzed using GeneMaker software v2.4.0 (SoftGenetics). Data were normalized using gDNA from 4 control reference samples. Copy number changes represented as a MLPA ratio were detected by comparing normalized peak intensities between the reference and the CLL samples. The MPLA ratio thresholds (X) were set as follows: 0.75 ≥ X ≤ 1.25, diploid sample; 0.4 ≥ X < 0.75, monoallelic deletion; X < 0.4, biallelic deletion. Samples showing either a standard deviation (SD) of control probes above 0.15, or samples with large Q fragment peaks and with more than 4 control probes having MLPA ratios out of diploid range were excluded from the analysis.
4
Quantifying BRCA1 Isoform Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Capillary fragment analysis was used to quantify eight observed isoform combinations. PCR amplification of cDNA was analogous to the isoform identification method described above, using a 5′ FAM-labeled forward primer in exon 17 (5′-TTTCGGAGGAGCTACTGGTG-3′), and an exon 20 reverse primer (5′-GTGCTCGTCCACGGTCAG-3′). The PCR amplicons were then supplemented with formamide and GeneScan 600 LIZ Size Standard (Thermo Fisher Scientific) and size separated on an ABI 3730 DNA Analyzer (Thermo Fisher Scientific). Analysis was performed with MAQ-S v1.5.0 software (Agilent). Manual inspection was performed to confirm that fluorescence signals corresponded to the expected size, and signal heights were within quantifiable range. Ratios for canonical, exon 18 cryptic splice acceptor, and exon 19 skipping isoforms were calculated as the signal area of the corresponding isoform peaks divided by the total area of these peaks.
5
Microsatellite Analysis of Genetic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples positive for two or more quality verification nuclear markers were used for microsatellite analysis. Twelve validated highly polymorphic microsatellite markers (MS1, MS2, MS5, MS6, MS7, MS8, MS9, MS10, MS12, MS15, MS20 and MS3.27) were amplified using hemi-nested PCR27 (link). Each 10-μL reaction consisted of 5 μL of the PrimeSTAR Max Premix (Takara-Bio, Kusatsu, Japan) and 1.25 μM of each primer (Supplementary Data 1 ). The primary PCR used 3 μL of DNA as a template, while the nested PCR used 1 μL of the primary PCR product. The cycling conditions for the primary PCR were as follows: 95 °C for 1 min; 40 cycles at 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s, and a final extension at 72 °C for 5 min. The cycling conditions for the nested PCR were as follows: 95 °C for 1 min, 35 cycles at 95 °C for 15 s, 61 °C for 30 s, 72 °C for 45 s and a final extension at 72 °C for 5 min. The nested PCR products were resolved on an Applied Biosystems 3730xl DNA Analyzer using the GeneScan 600 LIZ size standard (Thermo Fisher Scientific). Allele sizes were determined using Peak Scanner 2 (Thermo Fisher Scientific). Alleles with a minimum of one-third of the relative fluorescence units of the primary allele were recorded as secondary alleles.
6
DNA Fragment Analysis via Genetic Analyzer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One microliter of GlobalFiler™ or GlobalFiler™ Express (ThermoFisher Scientific, Carlsbad, CA, USA) amplified product was added to a mixture comprised of 9.5 μL Hi-Di™ formamide (ThermoFisher Scientific, Carlsbad, CA, USA) and 0.5 μL GeneScan™ 600 LIZ® size standard (ThermoFisher Scientific, Carlsbad, CA, USA). Samples were injected on an Applied Biosystems’ 3500 Genetic Analyzer using POP-4™ polymer and Module J6 (15 s injection, 1.2 kV, 60 °C) and analyzed using GeneMapper™ ID-X v1.6 software (ThermoFisher Scientific, Carlsbad, CA, USA).
7
RNASEH2B Gene Deletion Detection in CLL
8
Genotyping of Chickens Using Microsatellites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genotyping was also performed using 23 microsatellite markers, which were selected from among the 30 markers recommended by the FAO for studying the genetic diversity of chickens [17 ] (Supplementary Table S1 ). PCR amplification was performed via multiplex PCR based on two different microsatellite loci, using 10-μL reaction mixtures containing approximately 50 ng genomic DNA, 10 pmol of each primer, and 5.0 μL of AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific, USA). The cycling conditions were as follows: an initial denaturation at 95°C for 10 min; followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and elongation at 72°C for 30 s; and a final extension at 72°C for 7 min. PCR products were electrophoresed with Hi-Di Formamide (Thermo Fisher Scientific, USA) and a GeneScan 600 LIZ Size Standard (Thermo Fisher Scientific, USA) using the ABI PRISM 3130 Genetic Analyzer. Allele sizes were determined using Geneious Prime v2020.2.2 (Biomatters, Auckland, New Zealand).
9
Detailed Genetic Analyzer Protocol for Robust DNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One microliter of amplified product was added to a master mix consisting of 9.5 μL Hi-Di formamide (ThermoFisher Scientific, Carlsbad, CA, USA) and 0.5 μL GeneScan™ 600 LIZ™ size standard (ThermoFisher Scientific, Carlsbad, CA, USA). Module J6 (15 s injection, 1.2 kV, 60 °C) was used to inject samples on the 3500 Genetic Analyzer (ThermoFisher Scientific, Carlsbad, CA, USA) using POP-4TM polymer (ThermoFisher Scientific, Carlsbad, CA, USA). GeneMapperTM ID-X v1.6 (ThermoFisher Scientific, Carlsbad, CA, USA) software was used to analyze samples.
Analytical thresholds of Blue: 53, Green: 86, Yellow: 46, Red: 63, and Purple: 63 were determined using Equation (1), analyzing 30 negative control subsamples (i.e., thirty 0-cell subsamples as well as amplification blanks). No stutter filtering was applied within the GeneMapperTM software. However, half-back and double back stutter was manually removed from samples prior to analysis with EuroForMix due to the software only modeling forward and reverse stutter.
Analytical thresholds of Blue: 53, Green: 86, Yellow: 46, Red: 63, and Purple: 63 were determined using Equation (1), analyzing 30 negative control subsamples (i.e., thirty 0-cell subsamples as well as amplification blanks). No stutter filtering was applied within the GeneMapperTM software. However, half-back and double back stutter was manually removed from samples prior to analysis with EuroForMix due to the software only modeling forward and reverse stutter.
10
Microsatellite Genotyping by PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR amplification of the 50 microsatellite markers used in our previous study (Nunome et al., 2017 ) was performed using a 10‐µl reaction mix containing approximately 50 ng of genomic DNA, 10 pmol of each primer and 5 µl of Taq Gold 360 Master Mix (Thermo Fisher Scientific‐Applied Biosystems). The following PCR cycling conditions were used: initial denaturation at 95°C for 10 min, followed by 42 cycles at 95°C for 30 s, 50°C or 55°C for 30 s, and 72°C for 25 s, and a final extension at 72°C for 5 min. The nucleotide sequences and suitable annealing temperatures of all the primer sets were provided in our previous study (Tadano et al., 2014 ). Amplicons were electrophoresed with Hi‐Di formamide (Thermo Fisher Scientific) and the GeneScan 600 LIZ Size Standard (Thermo Fisher Scientific) using the ABI PRISM 3130 Genetic Analyzer (Thermo Fisher Scientific). Allele size was determined using GENEMAPPER version 4.1 (Thermo Fisher Scientific).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!