Tubeseq service

For sequencing of the ambiguous region upstream of TaMAX1a2-3B, PCR was performed with a Touchgene Gradient PCR machine (Techne, Staffordshire, UK), using Q5 high-fidelity DNA polymerase (New England BioLabs, Ipswich, MA, USA) following the manufacturer’s protocol and homoeologue-specific primers (Forward primer, GATTGTGGACTAATGACCGTGATTG; Reverse primer, TAGAAGTGCTTTTCGATGAAATCC; annealing temperature, 64 °C). After the amplification of the targeted region, PCR products were purified with the Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA), following the manufacturer’s protocol. The PCR products were sequenced using the TubeSeq service (Eurofins Genomics, Luxemburg, Luxemburg).

To enable the pharmacological characterisation of a candidate receptor for the A. rubens NPY/NPF/PrRP-like peptide, a cDNA encoding this receptor was cloned into the eukaryotic expression vector pcDNA 3.1(+) (Invitrogen; Cat. No. V790-20). To facilitate expression of the cloned receptor, the forward primer included a partial Kozak consensus sequence (ACC) and a sequence corresponding to the first 15 bases of the open reading frame of contig 1120879 (ACCATGCAGATGACAACC) and the reverse primer consisted of a stop codon and a sequence reverse complementary to the 3’ region of the open reading frame of contig 1120879 (GCGTCACATAGTGGTATCATG). PCR was performed using the forward primer and reverse primers, A. rubens radial nerve cord cDNA and Q5 polymerase (NEB; Cat. No. M0491S). PCR products were ligated into the pcDNA 3.1(+) vector that had been cut previously with the restriction enzyme EcoRV by performing blunt-end ligation with T4 DNA ligase (NEB; Cat. No. M0202S). Successful ligation and the direction of the insert was determined by restriction enzyme digestion and sequencing (TubeSeq service; Eurofins Genomics).

To identify the 3′ untranslated region (UTR) of S. kraussiana PINs, 3′ RACE PCR was performed. cDNA was synthesised as described above, but using the Q_T primer (Frohman, 1990 ; Frohman and Brook, 1994 (link)). The first round of PCR used a forward gene specific primer (GSP1) within a known exon in the middle of the transcript, and the Q_O primer (Frohman, 1990 ). The second round of PCR used the PCR product from the first round, a forward gene specific primer (GSP2) nested further downstream of GSP1, and the Q_I primer (Frohman, 1990 ). Q5 HF DNA Polymerase was used for all reactions according to the manufacturer's guidelines. For the 1st PCR, a 2 min extension with 58°C annealing temperature and 25 cycles were used. For the 2nd PCR, 35 cycles were used. The PCR product from the 2nd PCR was visualised by gel electrophoresis and extracted, incubated with Taq polymerase for 30 min at 68°C, and ligated into pGEM-T Easy overnight at 16°C according to the manufacturer's protocol. After transformation into TOP10 E. coli by electroporation, positive colonies were screened by digest or culture PCR, and then sequenced by Eurofins Genomics TubeSeq Service. Sequence results were aligned to the S. kraussiana genome to identify the 3′ UTR of each gene.

Some of the colonies selected for SCAR-PCR were also selected to confirm their identity via 16S rRNA gene PCR. The 16S rRNA gene PCRs were also performed for some of the colonies whose morphology indicated that they represent the natural microbiota of wheat seeds. The 16S rRNA gene PCRs were performed utilizing the following primers: 27F AGA GTT TGA TCM TGG CTC AG and 1492R CGG TTA CCT TGT TAC GAC TT [34 (link)]. PCRs were run utilizing illustra™ PuReTaq™ Ready-To-Go™ PCR beads (GE Healthcare, UK) supplemented with 1.25 μl of each primer (10 pmol/μl) and 22.5 μl of sterile ddH₂O. PCRs were run with the following program: 95 °C 2 min, 30x (95 °C 30 s, 55 °C 30 s and 72 °C 1 min), and 72 °C 7 min. PCR products were purified utilizing illustra™ GFX PCR DNA and Gel Band Purification Kit (GE Healthcare, UK). PCR products were analysed by agarose gel electrophoresis and sequencing. The 16S rRNA gene PCR products of 25 colonies (including one pure cultured MA250 and one E. coli DH5α) were submitted for sequencing and sequenced with the same 27F and 1492R primers as PCR (TubeSeq Service, Eurofins Genomics GmbH, DE). Sequencing results were compared to the sequences in the NCBI database by BLASTN suite MegaBLAST to fetch the reciprocal best hits for each colony.

A transcript encoding the A. rubens luqin-type precursor (ArLQP) has been identified previously (GenBank: KT601719;^{22 (link)}). Here a cDNA containing the complete open reading frame of ArLQP was amplified by PCR from A. rubens radial nerve cord total cDNA using specific primers (see supplementary Table 1) and Q5 proofreading polymerase (NEB; Cat. No. M0491S), cloned into pCR-Blunt II TOPO vector (Invitrogen; Cat. No. K280002) and sequenced (TubeSeq service; Eurofins Genomics). The amino acid sequence of ArLQP was aligned with luqin/RYamide-type precursors from other species (see supplementary Table 2 for a list of the sequences) using MAFFT version 7 (5 iterations, substitution matrix; BLOSUM62) and highlighted using the software BOXSHADE (www.ch.embnet.org/software/BOX_form.html) with 70% conservation as the minimum for highlighting.