The largest database of trusted experimental protocols

Stealth rnai sirna duplex oligoribonucleotides

Manufactured by Thermo Fisher Scientific
Sourced in United States

Stealth RNAi siRNA Duplex Oligoribonucleotides are chemically modified, double-stranded RNA molecules designed for RNA interference (RNAi) applications. They are engineered to reduce off-target effects and improve stability in biological systems.

Automatically generated - may contain errors

6 protocols using stealth rnai sirna duplex oligoribonucleotides

1

siRNA Transfection for Gene Silencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Target-specific siRNAs (Stealth RNAi siRNA Duplex Oligoribonucleotides, Invitrogen) were transfected using Lipofectamine RNAiMAX (Thermo Fisher Scientific, Waltham, MA, USA). Stealth RNAi siRNA Negative Control, Low GC (Thermo Fisher Scientific, Waltham, MA, USA) was used as a control siRNA. All siRNA nucleotide sequences are listed in Table 1.
+ Open protocol
+ Expand
2

GADD45γ Silencing via siRNA Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols
The specific small-interfering RNA of GADD45γ (Stealth RNAi siRNA Duplex Oligoribonucleotides) and Lipofectamine RNAiMAX gene transfection system were purchased from Invitrogen (Thermo Fisher Scientific, USA). Resuspend the Duplex siRNA in RNase-free buffer (10 mM Tris-HCl, pH 8.0, 20 mM NaCl, 1 mM EDTA). The transfection protocol was according Lipofectamine RNAiMAX's manual.
+ Open protocol
+ Expand
3

TACC2 Silencing with Stealth RNAi Oligonucleotides

Check if the same lab product or an alternative is used in the 5 most similar protocols
Two siRNA oligonucleotides for TACC2 used in this study were Stealth RNAi siRNA Duplex Oligoribonucleotides (Invitrogen). The target sequences of siRNA against TACC2 were TACC2HSS116287 (si1): 5′‐GCUAAAGGUACUUACACCUUGAUA‐3′ (sense) and 5′‐UAUCAAAGGUGUAAGUACCUUUAGC‐3′ (anti‐sense) and TACC2HSS116288 (si2): 5′‐CCCUUCAGAAGCGAUUGAAAUUACA‐3′ (sense) and 5′‐UGUAAUUUCAAUCGCUUCUGAAGGG‐3′ (anti‐sense). Universal RNAi Negative Control Duplexes (NC; Sigma–Aldrich) were also used as the negative control siRNAs. The siRNAs (10  nmol/L) were transfected with the Lipofectamine RNAiMAX Transfection Reagent (Invtrogen) in accordance with the manufacturer's protocol.
+ Open protocol
+ Expand
4

HK-2 Cell Regulation by siRNA and LPS

Check if the same lab product or an alternative is used in the 5 most similar protocols
HK-2 cells were seeded in 6-well plates at a density of 2 × 105 cells per well without antibiotics in the medium for 24 h. Orifice plates were divided into four groups: Con, LPS, siRNA and siRNA + LPS and three wells per group were used. Con and LPS-treated cells were incubated with medium, and siRNA and siRNA + LPS-treated cells were grown and transfected with 6 pM siRNA using Stealth RNAi siRNA Duplex Oligoribonucleotides and RNAiMAX ((Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Cells were incubated for 36 h and then placed in D-MEM/F12 medium with LPS (50 μM) which was replaced in LPS and siRNA + LPS groups for 3 h and serum-free medium was used in Con and siRNA groups. To quantify NGAL and caspase 3 mRNA expression, RNA was harvested and cDNA was synthesized.
+ Open protocol
+ Expand
5

Targeted siRNA Knockdown Methodology

Check if the same lab product or an alternative is used in the 5 most similar protocols
Target-specific siRNAs (Stealth RNAi siRNA Duplex Oligoribonucleotides, Thermo Fisher Scientific, Waltham, MA, USA) were transfected using Lipofectamine RNAiMAX (13778100, Thermo Fisher Scientific, Waltham, MA, USA). Stealth RNAi siRNA Negative Control, Low GC (12935110, Thermo Fisher Scientific, Waltham, MA, USA) was used as the control siRNA.
siTBK1-15′-GCGAGAUGUGGUGGGUGGAAUGAAU-3′siTBK1-25′-GGGAACCUCUGAAUACCAUAGGAUU-3′siFBXO22-15′-UCGUGUGGUCCUUGUCUUUGGUUAU-3′siFBXO22-25′-GCUGUAAGGUGGGAGCCAGUAAUUA-3′
+ Open protocol
+ Expand
6

HO-1 Silencing Protocols using Stealth RNAi™ siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Stealth RNAi™ siRNA Duplex Oligo ribonucleotides [Hmox1 RNAi (Thermo Fisher Scientific) and Stealth RNAi™ siRNA Negative Controls (Thermo Fisher Scientific)] for HO-1 and negative control small interfering RNAs (siRNA) were used for RNA interference. The sense and antisense strands of HO-1 siRNA were as follows:
sequence #1, 5′-CAGCUCUAUCGUGCUCGAAUGAACA-3′ (sense)
and 5′-UGUUCAUUCGAGCACGAUAGAGCUG-3′ (antisense);
sequence #2, 5′-GCUUUAAGCUGGUGAUGGCUUCCUU-3′ (sense)
and 5′-AAGGAAGCCAUCACCAGCUUAAAGC-3′ (antisense);
sequence #3, 5′-GGCAGUGGGAAUUUAUGCCAUGUAA-3′ (sense)
and 5′-UUACAUGGCAUAAAUUCCCACUGCC-3′ (antisense).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!