RNA was isolated using RNeasy Plus Mini Kit (Qiagen), and cDNA was prepared using Superscript First Strand Synthesis System for RT-PCR Kit (Biorad) following manufacturers’ instructions. Quantitative real-time PCR was performed using manufacturers’ instructions for SSO advanced SYBR green kit (Biorad) on ABI-qPCR system using equal amount of template (50–100 ng cDNA) per reaction. Obtained values were normalized to housekeeping gene (RPL30) and are presented as fold differences over control using the ∆∆Ct method for relative quantifications. Each comparison was made using triplicate reactions and in at least 3 independent experiments. P-values were calculated using Student's t-test. Primer sequences for different analyzed genes are described in detail in (SI Table 1).
Ssoadvanced sybr green kit
Manufactured by Bio-Rad
The SsoAdvanced SYBR Green kit is a real-time PCR reagent designed for sensitive and reliable gene expression analysis. It includes a proprietary DNA polymerase, optimized buffer, and SYBR Green I dye for detection of double-stranded DNA amplification.
Automatically generated - may contain errors
Lab products found in correlation
Quantitect reverse transcription kit, by Qiagen (2 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Mlv rt, by Promega (1 mentions)
Prism v7.0a, by GraphPad (1 mentions)
Dnase, by Promega (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Cfx connect, by Bio-Rad (1 mentions)
Nucleospin rna kit, by Macherey-Nagel (1 mentions)
Iscript kit, by Bio-Rad (1 mentions)
Lightcycler 96 machine, by Roche (1 mentions)
5 protocols using ssoadvanced sybr green kit
1
Quantitative Real-Time PCR Analysis
2
RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified using Omega Biotek E.Z.N.A. microelute kit, and reverse transcribed to generate cDNA using QuantiTect Reverse Transcription Kit (Qiagen) as described in Voronova et al. (2017) (link). qPCR was performed using the Ssoadvanced SYBR Green kit (BioRad), primers listed in the supplemental materials and methods , and using Eppendorf Realplex2 (Eppendorf) instrument. Data were normalized to Gapdh and Hnrnpab and analyzed using 2−ΔΔCt method.
3
Quantifying Gene Expression in Drosophila
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For all experiments utilizing RT-qPCR, total RNA was extracted from pools of 20 flies using a standard TRIzol (Invitrogen) extraction. RNA samples were treated with DNase (Promega), and cDNA was generated using murine leukemia virus reverse transcriptase (MLV-RT) (Promega). qPCR was performed using the SSO Advanced SYBR green kit (Bio-Rad) in a Bio-Rad CFX-Connect instrument. Data represent the relative ratio between the Ct value of the target gene and that of the reference gene RpL32 (also known as Rp49). Mean values of at least three biological replicates are represented ±SE. Data were normalized and then analyzed using an unpaired t-test in Prism (GraphPad Prism V7.0a; GraphPad Software, La Jolla, CA, USA). The primer sequences used in this study are available in S6 Table .
4
Quantifying Cardiac and Hepatic BMP10 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA was extracted from cardiac right atria and from liver tissue using a nucleospin RNA kit (Macherey, Nagel). Reverse transcription was performed using iScript kit from Biorad and quantitative polymerase chain reaction was performed using SsoAdvanced SYBR green kit from Biorad. The Delta-Delta Ct (∆∆Ct) method was used to obtain relative Bmp10 expression levels (TCCATGCCGTCTGCTAACATCATC; ACATCATGCGATCTCTCTGCACCA), normalized to Rpl13a levels (CCCTCCACCCTATGACAAGA; TTCTCCTCCAGAGTGGCTGT).
5
Quantification of Neurosphere RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was generated from 20 to 70 ng of total RNA isolated from primary or secondary neurospheres using QuantiTect Reverse Transcription Kit (Qiagen) as per the manufacturer’s instructions. A no-RT control was included to verify genomic DNA elimination. 1/100th of the RT reaction was used as a template for the QPCR amplification. QPCR was performed according to MIQE guidelines [71 (link)] using the Ssoadvanced SYBR Green kit (BioRad) on the Roche LightCycler 96 machine with the following primers: Ankrd11 exon 7: Forward 5’-GCGTGTAACCGGGGCTATTAC-3’; Reverse 5’-CGTTGTTGGCGGCATCATG-3’, 40 cycles of; 95 °C 15 s, 60 °C 15 s, 72 °C 20 s. Gapdh; Forward 5’-AAATACGGACTGCAGCCCTC-3’; Reverse 5’-AAATCCGTTCACACCGACCTT-3’, 40 cycles of; 95 °C 15 s, 60 °C 15 s, 72 °C 20 s.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!