The largest database of trusted experimental protocols

Ham s f 12k kaighn s medium

Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom

Ham's F-12K (Kaighn's) Medium is a cell culture medium designed for the growth and maintenance of a variety of mammalian cell lines. It provides the necessary nutrients and supplements to support cell growth and proliferation.

Automatically generated - may contain errors

84 protocols using ham s f 12k kaighn s medium

1

Alveolar Macrophage and Fibroblast Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rat alveolar macrophage NR8383 cells (CRL-2192, ATCC, Manassas, VA, USA) were cultured at 37 °C in a humidified environment containing 5% CO2 in Ham’s F-12K (Kaighn’s) medium (Life Technologies, Grand Island, NY, USA), supplemented with 15% fetal bovine serum (FBS) (Life Technologies). Human lung fibroblast WI-38 cells (ATCC; no. CCL-75) were cultured at 37 °C in a humidified environment containing 5% CO2 in Eagle's minimum essential medium (ATCC) supplemented with 10% FBS and 100 U ml–1 penicillin–streptomycin (Life Technologies). Resveratrol with a purity ⩾99% (high-performance liquid chromatography (HPLC)) and 5Z-7-oxozeaenol with a purity ⩾98% (HPLC) were purchased from Sigma (St Louis, MO, USA). Chalcone derivative (4′-hydroxychalcone) with a purity ⩾98% (HPLC) was purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Silica particles, silicon dioxide (SiO2), with an average diameter of 1.6 μm were purchased from US Silica MIN-U-SIL-5, US Silica, Shanghai, China. Human recombinant TGF-β (TGF-β1) was purchased from Merck Millipore (Danvers, MA, USA). Cross-species TAK1 siRNA and NC siRNA were purchased from Cell Signaling Technology (Danvers, MA, USA) and transfected into cells using the Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. SIRT1 Activity Assay Kit was from Abcam (Cambridge, MA, USA).
+ Open protocol
+ Expand
2

Cell Culture Protocol for HepG2, MEF, and HUVEC

Check if the same lab product or an alternative is used in the 5 most similar protocols
HepG2 cells and immortalized mouse embryonic fibroblasts (MEFs) were cultured in DMEM (Mediatech, Manassas, VA, USA) with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin (Mediatech, Manassas, VA, USA). Mpg+/+ and Mpg−/− MEFs were a gift from Dr Leona Samson, Massachusetts Institute of Technology (27 ). HUVECs were cultured in Ham's F-12K (Kaighn's) Medium (Life Technologies, Grand Island, NY, USA) supplemented with 10% FBS, 1% penicillin–streptomycin, 0.1 mg/ml heparin (Sigma, St Louis, MO, USA) and 0.03 mg/ml endothelial cell growth supplement (ECGS) (Sigma, St Louis, MO, USA).
+ Open protocol
+ Expand
3

Cell Culture and Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
AGS cell lines were purchased from ATCC (Manassas, VA, USA) and cultured in Ham’s F-12 K (Kaighn’s) medium (Life Technologies) supplemented with 10% foetal bovine serum (FBS, Life Technologies) and 1% penicillin G/streptomycin (Life Technologies). BGC823, MGC803, MKN45 and EAhy926 cell lines were purchased from Cell Bank, Shanghai Institutes for Biological Sciences (Cell Bank, CAS, Shanghai, China) and cultured in RPMI 1640 medium (Life Technologies) supplemented with 10% FBS and 1% penicillin G/streptomycin. All cell lines were incubated at 37 °C in an atmosphere of 95% air and 5% CO2. The cell lines were checked free of mycoplasma contamination by PCR and culture, and authenticated with STR profiling (FBI, CODIS, http://cellresource.cn).
miR-632-mimic (25 nM) and miR-632-inhibitor (50 nM) were purchased from Qiagen. The cell transfection method was described previously [28 (link)].
+ Open protocol
+ Expand
4

Cell Culture of Lung Carcinoma and Osteosarcoma

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human lung carcinoma cell line A549 (kind gift from Dr. Paloma Navarro, Spanish National Cancer Research Centre, CNIO) was grown in Ham’s F-12 K (Kaighn’s) medium (Life Technologies, Carlsbad, California), supplemented with 10% fetal bovine serum (FBS) (Life Technologies), antibiotic-antimycotic 1X (Life Technologies) and Plasmocin™ 5 μg/ml (InvivoGen, San Diego, California). Saos-2 human osteosarcoma cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA), cultured in Dulbecco’s modified Eagle’s medium (DMEM, Life Technologies) and supplemented as Ham’s F-12 K (Kaighn’s) medium. Cell cultures were maintained at 37°C under 5% CO2.
+ Open protocol
+ Expand
5

Characterization of Conjunctival Melanoma Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Two CM cell lines, CRMM1 and CRMM2, were kindly provided by Prof. Dr. Martine Jager, Leiden University Medical Center, the Netherlands. A normal conjunctival epithelial cell line, HCjE‐Gi, was kindly provided by Prof. Dr. Colin Willoughby, University of Liverpool, UK. All cell lines were tested for authentication via Short Tandem Repeat (STR) before initiation of the experiments and were mycoplasma free at the time of experimentation. The CRMM1 and CRMM2 cell lines derived from a spindle cell tumour originally located in the bulbar conjunctiva (Keijser et al. 2007; Nareyeck et al. 2007). The CM cell lines were grown in Ham's F‐12K (Kaighn's) Medium (Life Technologies, Paisley, UK) containing 10% fetal bovine serum (Labtech International Ltd, East Sussex, UK) and 1% Penicillin Streptomycin (Life Technologies). The normal HCjE‐Gi cell line was grown in Keratinocyte Medium with Human Recombinant Epidermal Growth Factor and Bovine Pituitary Extract (Life Technologies) containing 10% fetal bovine serum (Labtech International Ltd). All cell lines were maintained as monolayers in 75‐cm2 tissue culture flasks (Fisher Scientific, Loughborough, UK) at 37°C in a humidified atmosphere containing 5% CO2 prior to their use as described below:
+ Open protocol
+ Expand
6

Culturing Human Prostate Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human PCa cell lines 22RV1, LNCaP, PC3, and DU145 as well as human non-tumor prostatic cell line WPMY-1 were obtained from the Cell Bank of Chinese Academy of Sciences (Shanghai, China). Among them, 22RV1 and LNCaP cells were cultured in RPMI-1640 medium (Thermo Fisher Scientific, USA) supplemented with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, USA), 1% glutamax (Thermo Fisher Scientific, USA), and 1 mM sodium pyruvate (Thermo Fisher Scientific, USA); PC-3 cells were cultured in Ham's F-12K (Kaighn's) medium (Thermo Fisher Scientific, USA) supplemented with 10% FBS (Thermo Fisher Scientific, USA); DU145 cells were cultured in MEM medium (Thermo Fisher Scientific, USA) supplemented with 10% FBS (Thermo Fisher Scientific, USA), 1% glutamax (Thermo Fisher Scientific, USA), 1% non-essential amino acids (Thermo Fisher Scientific, USA) and 1 mM sodium pyruvate (Thermo Fisher Scientific, USA); WPMY-1 cells were cultured in DMEM medium (Thermo Fisher Scientific, USA) containing 10% FBS (Thermo Fisher Scientific, USA). To inhibit the growth of bacteria, the medium was also supplemented with 100 U/mL penicillin and 100 μg/mL streptomycin (Thermo Fisher Scientific, USA), respectively. All cell lines were incubated at 37°C in a 5% CO2 atmosphere.
+ Open protocol
+ Expand
7

CRISPR Screening of Host Factors for SARS-CoV-2 Infection

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human ACE2 coding sequence was cloned into a lentiviral vector as described (23 (link)). sgRNAs targeting human ORAI1 (gRNA target sequence GATCGGCCAGAGTTACTCC) and human STIM1 (TGAGGATAAGCTCATCAGCG) genes were subcloned into pLentiguide puro (Addgene). sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1) subcloned into pLentiCRISPR v2 was purchased from GenScript (catalog # IFNAR1 crRNA 1; gRNA target sequence GGCGTGTTTCCAGACTGTTT). Vero E6, HEK293 and A549 cells were obtained from the American Type Culture Collection center (ATCC, Manassas, VA). Vero cells were cultured in EMEM growth media (ATCC) supplemented with 10% (v/v) fetal bovine serum (FBS, Hyclone) and Penicillin/Streptomycin (Mediatech) at 37°C and 5% CO2. HEK293 cells were cultured in DMEM (Mediatech) supplemented with 10% (v/v) FBS (Hyclone), 2 mM L-glutamine (Mediatech), 10 mM HEPES (Mediatech) and Penicillin/Streptomycin (Mediatech) at 37°C and 5% CO2. A549 cells were cultured in Ham’s F12-K (Kaighn’s) medium (ThermoFisher) supplemented with 10% (v/v) FBS (Hyclone), 10 mM HEPES (Mediatech) and Penicillin/Streptomycin (Mediatech) at 37°C and 5% CO2.
+ Open protocol
+ Expand
8

Culturing HUVEC and HFL1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human umbilical vein endothelial cells (HUVEC) and human fetal lung fibroblast 1 (HFL1) cells were obtained from the American Type Culture Collection. HUVEC were cultured with a VascuLife® VEGF Endothelial Medium Complete Kit (Lifeline Cell Technology; Frederick, MD, USA), and HFL1 cells were cultured with Ham’s F-12K (Kaighn’s) Medium (Thermo Fisher Scientific Inc., Waltham, MA, USA) with 10% fetal bovine serum albumin. Collagen Type 1 coated plates (Iwaki, Holliston, MA, USA) were used for HUVEC culture. For HFL1 cells, standard culture flasks were used.
+ Open protocol
+ Expand
9

Growth Conditions for C6 Rat Glioma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
C6 rat glioma cells (CCL-107, American Type Culture Collection, Manassas, VA) were grown in Ham's F-12K (Kaighn's) medium (ThermoFisher Scientific, Waltham, MA) containing 2.5% fetal bovine serum, 15% horse serum, and 1% penicillin–streptomycin. All cells were grown at 37°C in a 5% CO2 incubator. Cells were regularly confirmed to be mycoplasma-negative using the MycoAlert Mycoplasma Detection Kit (Lonza, Basel, Switzerland).
+ Open protocol
+ Expand
10

Heterologous Expression of ASIC Channels

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cDNAs used for heterologous expression of ASIC channels were as follows: human ASIC1a, GenBank ID: U78181; rat ASIC1b, GenBank ID: 3445467; human ASIC2a, GenBank ID: U57352; rat ASIC3, GenBank ID: 27465600. The ASIC1a-C466A-C471A-C497A-C528stop cDNA construct51 (link) was kindly provided by Miguel van Bemmelen (University of Lausanne, Switzerland). The experiments with recombinant human ASIC1a in the present study were carried out with the ASIC1a clone containing the mutation G212D, whose main effect is an acceleration of the desensitization kinetics.52 (link) All constructs were expressed in Chinese hamster ovary (CHO) cells. The transient transfection of CHO cells was performed as reported previously.52 (link) In brief, CHO cells were cultured at 37°C in a humidified atmosphere with 5% (v/v) CO2, and passaged twice a week. CHO cells were transiently co-transfected with ASIC and EGFP cDNA, using Rotifect transfection reagent (Carl Roth, D-Karlsruhe). CHO cells were cultured in Ham’s F-12K (Kaighn’s) medium (ThermoFisher Scientific) supplemented with 10% (v/v) fetal bovine serum (FBS, ThermoFisher Scientific) and 1% penicillin–streptomycin (5000 U·mL-1, ThermoFisher Scientific). Electrophysiological measurements were performed 24–48 h after transfection.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!