Clc genomic workbench version 10

DNA of the clinical isolate for sanger sequencing was extracted using DNeasy UltraClean Microbial kit (QIAGEN, Tokyo, Japan). The ITS region of ribosomal DNA (rDNA) was amplified using fungal universal primers Its1 (5’- TCCGTAGGTGAACCTGCGG -3’) and Its4 (5’- TCCTCCGCTTATTGATATGC -3’) (Zhai et al., 2021 (link)). The PCR products were sequenced using 3500 XL genetic analyzer (ABI-Hitachi, Tokyo, Japan). Sequence data were analyzed using BLAST on the National Center for Biotechnology Information (NCBI) database.
Genomic DNA of the clinical isolate for whole genome sequencing was extracted as described previously (Mizukoshi et al., 2021 (link)). The genome was sequenced by Illumina MiSeq platform using v3 chemistry (600 cycles). Raw reads were trimmed and assembled using CLC Genomic Workbench version 10.0.1 (CLC bio, Aarhus, Denmark). The genome completeness and contamination were assessed using Eukcc v2.1.0 with default settings (Saary et al., 2020 (link)). Species identification of the isolate was also determined by ITS using BLAST. Amino acid substitutions in BCR1, BRG1, CBK1, EFG1, and IRE1 (Talapko et al., 2021 (link)) associated with virulence, in ERG3, ERG11, PDR1, and TAC1 associated with azole resistance, and in FKS1, FKS2, and GSC1 (Spettel et al., 2019 (link)) associated with echinocandin resistance in Candida species were analyzed based on whole genome sequencing.

Genomic DNA of the 33 clinical M. abscessus isolates were extracted using DNeasy blood and tissue kits (Qiagen, Tokyo, Japan) and DNA libraries were prepared using Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA). Their genomes were sequenced by Illumina MiSeq platform using v3 chemistry (600 cycles) and the summary of the assembly is shown in Supplementary Table S5. Raw reads of each isolate were trimmed and assembled using CLC Genomic Workbench version 10.0.1 using quality control and assembly tools with default settings (CLC bio, Aarhus, Denmark). Species identities of these isolates were determined using an ANI calculator^{33 (link)} and the sequences of 16S rRNA, rpoB, hsp65, and erm genes^{12 (link),15 (link)}. The ANI values and sequence identities of 16S rRNA, rpoB, hsp65, and erm genes were calculated and adopt the closest of the reference genomes of M. abscessus subsp. abscessus (ATCC 19977^T, genome accession number GCF_000069185.1), M. abscessus subsp. bolletii (JCM 15297^T, GCF_003609715.1), and M. abscessus subsp. massiliense (JCM 15300^T, GCF_000497265.2)^{27 (link)}. The mutations of erm and rrl genes were detected in silico using CLC Genomics Workbench^{34 (link)}.