Rotor gene q 6000 machine

Total DNA from mesenteric nodes was isolated by a DNA extraction kit (Genet Bio). Subsequently, HTLV1 proviral DNA load (PVL) was evaluated to confirm the HTLV1 infection. Real‐time PCR was carried out using a PCR mixture (2 µl of extracted DNA, 1 µl of primers and probe, 2 µl of distilled water, 5 µl of TaqMan Master Mix) and a RotorGene Q 6000 machine (Corbett Research). The forward HTLV1 DNA primer, 5′‐CCCTACAATCCAACCAGCTCAG‐3, probe, 5′‐ FAM‐CTTTACTGACAAACCCGACCTACCC ATGGA‐ BHQ13, reverse HTLV1 DNA primer, 5′‐GTGGTGAAGCTGCCATCGGGTTTT‐3′, forward albumin primer, 5′‐CCTTGTCACTAGATGCAAAG‐3′, probe, 5′‐FAM‐CACATCACAACCACAACCTTCTCAG‐BHQ1‐3′ and reverse albumin primer 5′‐GACCATACGTGAAGACCTAA‐3′ were used. DNA concentrations of HTLV1 and the reference gene of albumin were quantified in accordance with standard curves. Finally, PVL per 10⁴ cells equaled ((copies number of HTLV1 DNA/copies number of albumin DNA/2) ×10⁴).