Minirna extraction kit

For gene expression detection, total RNA was isolated from whole cells using the Qiagen miniRNA extraction kit following the manufacturer’s instructions. RNA was quantified and complementary DNA was reverse-transcribed using the cDNA archival kit (Applied Biosystems) following the manufacturer’s instructions. The cDNA samples were used at 20ng/well in a 384 well plate and run in triplicate. PCR reactions were set up using TaqMan Universal PCR Master Mix (Applied Biosystems) on an ABI Prism 7500 Sequence Detection System. Quantification of relative mRNA expression was normalized to the expression of GAPDH. Primers-probe mixtures were purchased from Applied Biosystems: Foxp3 (Mm00475162), MSC (Mm00447887), Gata1 (Mm01352636), Gata3 (Mm00484683), Il4 (Mm00445259), Il5 (Mm00439646), Il13 (Mm00434204), Tcf3 (Mm01188711), Tcf12 (Mm00441699), GAPDH (4352339E).

Total RNA was extracted from organoids using mini RNA extraction kit
(Qiagen). cDNA was synthesized using Superscript III kit (Invitrogen, Thermo
Fisher Scientific, Waltham, MA, USA). Quantitative real-time PCR was performed
on a real-time PCR System (Bio-Rad) using SYBR green assays. We used Beta 2
microglobulin (B2M) as endogenous control gene (10 (link)). Mouse and human primer sequences were
described earlier (3 (link), 10 (link)) and for Gpbar1,
5Htr3a, 5Htr3b and 5Htr4are presented in Table
1. Each gene expression was tested in 2-4 organoid lines from
different mice generating 2-4 templates from each line from different passages
(biological replicates, n) in independent experiments. The individual
measurements were averaged from duplicated qPCR wells (technical
replicates).

Human CD8⁺ T cells were obtained from the Human Immunology Core at the University of Pennsylvania. Murine CD4⁺ and CD8⁺ T cells were isolated from spleen or tumor tissue using T cells isolation kits (Stem cell, cat#19853 and 19765A). Human and murine CD8⁺ T cells were stimulated with anti-mouse CD3 (BioLegend, cat#100340) and anti-CD28 antibodies (BioLegend, cat#102116) for 24 hr in the presence or absence of Thapsigargin (100nM, cat#67526–96-8) or treated with tumor-conditioned medium (TCM) or fibroblast-conditioned medium (FCM) for 48 hr. After treatment, total of RNA was extracted from CD8⁺ T cells using Mini RNA extraction kit (Qiagen, cat#74004). Concentration of RNA was measured by nanodrop2000 and the mRNA expression of Atf4 and Ddit3 were tested using real-time PCR and results were normalized per β-actin mRNA levels. Primers are as follows: mouse Atf4 Forward: CCTGAACAGCGAAGTGTTGG and Reverse: TGGAGAACCCATGAGGTTTCAA; mouse Ddit3 Forward: GGAGCTGGAAGCCTGGTATG and Reverse: GGATGTGCGTGTGACCTCTG; mouse Actb Forward AGAGGGAAATCGTGCGTGAC and Reverse: CAATAGTGATGACCTGGCCGT; Human ATF4 Forward: AAACCTCATGGGTTCTCCAG and Reverse: GGCATGGTTTCCAGGTCATC; Human DDIT3 Forward: AGCACCAAAGCAGCCAT and Reverse: ACTCAGCTGCCATCTCTG; Human ACTB Forward: AGCACAGAGCCTCGCCTT and Reverse: CATCATCCATGGTGAGCTGG.

Fourteen primary cultures of GBM PDXs were collected and used within 5 passages. Total RNA of primary cells was extracted using Qiagen mini RNA extraction kit with trizol. RNA samples were submitted to Weil Cornell Medicine genomics core for RNA-seq using Hiseq4000 Illumina sequencer. The transcript raw counts were aligned to Refseq related to build GRCh37-hg19 using STAR 2.4.2.8 by default settings on MSKCC high performance computation clusters.
The genes from raw counts matrix of 14 samples were kept only when at least 2 out of 14 samples have normalized counts per million mapped reads more than one calculated by edgeR package. To determine the subtypes of PDX cultures, we applied the same GSVA algorithm to calculate single sample enrichment scores using differentially expressed genes (adjusted p >0.05 and fold change >2) from direct comparison of TCGA Type I and Type II core GBM as gene sets. The TIDEG included 134 upregulated genes in Type I GBM core sample and the TIIDEG had 146 genes (Table S5). In consideration of the differences between in vivo primary tumor tissue and in vitro primary cultures, we applied a less stringent criteria for subtyping PDX cells, where Type I GBM is defined by TIDEGScore>0 & TIIDEGScore<0 and Type II GBM is TIDEGScore<0 and TIIDEGScore>0. We obtained 4 Type I, 7 Type II and 3 non-Type I & II GBM cultures from the PDX cohort.

For gene expression detection, total RNA was isolated from whole cells using the QIAGEN miniRNA extraction kit following the manufacturer’s instructions. RNA was quantified and complementary DNA was reverse-transcribed using the cDNA archival kit (Applied Biosystems) following the manufacturer’s instructions. The cDNA samples were used at 20 ng/well in a 384-well plate and run in triplicate. PCRs were set up using TaqMan Universal PCR Master Mix (Applied Biosystems) on an ABI Prism 7500 Sequence Detection System. Quantification of relative mRNA expression was normalized to the expression of GAPDH. Primer-probe mixtures were purchased from Applied Biosystems: Foxp3 (Mm00475162); Foxo1 (Mm00490672-m1); Il23r (Mm00519943-m1); Rorc (Mm01261022-m1); Il2r (Mm01340213_m1); Sgk1 (Mm00441380-m1); Ifng (Mm01168134_m1); GAPDH (4352339E).