T7 polymerase

Manufactured by Roche

Sourced in United States, Germany

The T7 polymerase is an enzyme that transcribes DNA into RNA. It is a highly processive and specific RNA polymerase derived from the T7 bacteriophage. The T7 polymerase can be used in various molecular biology applications such as in vitro transcription and gene expression studies.

Automatically generated - may contain errors

Lab products found in correlation

Nbt bcip substrate, by Roche (6 mentions) Pgem t easy vector, by Promega (4 mentions) T3 polymerase, by Roche (3 mentions) Dig rna labelling mix, by Roche (2 mentions) Cm3050s cryostat, by Olympus (2 mentions) Ix71 inverted microscope, by Olympus (2 mentions) Pdrive plasmid, by Qiagen (2 mentions) Pcr purification kit, by Qiagen (2 mentions) Digoxigenin 11 utp, by Merck Group (2 mentions) Sp6 polymerase, by Roche (2 mentions) Ap conjugated anti dig antibody, by Roche (2 mentions) Bm purple ap substrate, by Roche (2 mentions) Dig rna labelling kit, by Roche (2 mentions) Topo ta cloning kit, by Thermo Fisher Scientific (2 mentions) Rnamaxx high yield transcription kit, by Agilent Technologies (2 mentions) Lsm 700 confocal microscope, by Zeiss (2 mentions) Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions) Dig rna labeling mixture, by Roche (1 mentions) Pcdna3 vector, by Thermo Fisher Scientific (1 mentions) T7 rna polymerase, by Roche (1 mentions)

Close spelling variants of this product

T7 RNA polymerase (320 citations) T7 or SP6 RNA polymerase (39 citations) T7 and SP6 RNA polymerases (28 citations) T7/SP6 RNA polymerase (28 citations) SP6 or T7 polymerase (13 citations) T3 or T7 RNA polymerase (8 citations) Biotin RNA Labeling Mix and T7 RNA polymerase (7 citations) T7/SP6 RN polymerase (5 citations) T3 or T7 polymerase (4 citations) T7 RNA polymerase kit (4 citations)

39 protocols using t7 polymerase

In Situ Hybridization of Developing Ears

Check if the same lab product or an alternative is used in the 5 most similar protocols

Developing ears (2-3 mm stage) were dissected from six-week old field-grown plants, followed by fixing, embedding and in situ hybridization as described³⁰, with 16h substrate incubation. RA3 probes were as previously reported^{3 (link)}, and for TPP4, two fragments were amplified for each from cDNA using primer pairs GCCTACATGAGCGACGTGAT/CCTCTTCCTCAGCACCTTGA and GTTGGGACGATCGAGAAAGT/GGCGTAGTAGAGCTCCGACA, and subcloned into pCR2.1. Clones carrying inserts in both orientations were identified and sequence-verified to generate antisense or sense probes by in vitro transcription with T7 polymerase (Roche).

Claeys H., Vi S.L., Xu X., Satoh-Nagasawa N., Eveland A.L., Goldshmidt A., Feil R., Beggs G.A., Sakai H., Brennan R.G., Lunn J.E, & Jackson D. (2019). Control of meristem determinacy by trehalose-6-phosphate phosphatases is uncoupled from enzymatic activity. Nature plants, 5(4), 352-357.

+ Open protocol

+ Expand

Cloning and Labeling of clcc1 cDNA Probe

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 5′-probe specific for the clcc1 cDNA clone was amplified by PCR and cloned into the pcDNA3 vector (Invitrogen). The following primers were used to prepare clcc1 probes (the size of the amplicon is 1192 bp): clcc1- ISH-PrimerF, aggtgaagctttccaagcag, clcc1- ISH-PrimerR, gaagatggtggctcactgg. The digoxigenin-labeled cRNA probe was synthesized by in vitro transcription of the corresponding linearized plasmids using T7 polymerase and DIG-RNA-labeling mixture (Roche). Whole mount in situ hybridization was performed as described previously [39 (link)].

Li L., Jiao X., D’Atri I., Ono F., Nelson R., Chan C.C., Nakaya N., Ma Z., Ma Y., Cai X., Zhang L., Lin S., Hameed A., Chioza B.A., Hardy H., Arno G., Hull S., Khan M.I., Fasham J., Harlalka G.V., Michaelides M., Moore A.T., Coban Akdemir Z.H., Jhangiani S., Lupski J.R., Cremers F.P., Qamar R., Salman A., Chilton J., Self J., Ayyagari R., Kabir F., Naeem M.A., Ali M., Akram J., Sieving P.A., Riazuddin S., Baple E.L., Riazuddin S.A., Crosby A.H, & Hejtmancik J.F. (2018). Mutation in the intracellular chloride channel CLCC1 associated with autosomal recessive retinitis pigmentosa. PLoS Genetics, 14(8), e1007504.

+ Open protocol

+ Expand

Synthesizing and Detecting mRNA Probes in P. tepidariorum

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pt-foxQ2 antisense mRNA probes for ISHs were synthesized from the entire cloned sequence (979 bp) with the DIG RNA labelling Mix using the T7 RNA polymerase (both Roche, DIG RNA labelling Mix with Cat.-No.: 11277073910 and T7 Polymerase with Cat.-No.: 10881767001). The Pt-six3.1 and Pt-six3.2 antisense mRNA probes were those used in Schomburg et al. (2015 (link)) and are of 1439 bp and 1328 bp length, respectively. ISHs and nuclear SYTOX® Green staining in P. tepidariorum embryos were carried out as described previously (Prpic et al. 2008 (link); Pechmann and Prpic 2009 (link)).

Schacht M.I., Schomburg C, & Bucher G. (2020). six3 acts upstream of foxQ2 in labrum and neural development in the spider Parasteatoda tepidariorum. Development Genes and Evolution, 230(2), 95-104.

+ Open protocol

+ Expand

High-Resolution In Situ Hybridization Protocol

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Digoxigenin (DIG)-labeled antisense riboprobes were made for each gene by T7 Polymerase (Roche) and a DIG RNA labeling kit (Roche) according to the manufacturer’s instructions. A high-resolution in situ hybridization protocol was performed based on Thisse et al. and previous publications [32 (link),33 (link)]. The sequence and probe generation of ephrinb2, mrc1, and stabilin have been disclosed in previous studies [34 (link),35 (link)]. In short, embryos were preserved with 4% paraformaldehyde (PFA) and kept in methanol at −20 °C to dehydrate. Samples were rehydrated in phosphate-buffered saline with 0.1% Tween-20 (PBST) and then partially digested with proteinase K. Embryos were incubated overnight at 70 °C with the RNA probe in a 50% formamide-based hybridization solution. After the washing and blocking processes, an anti-Dig conjugated with alkaline phosphatase antibody was added to the embryos and incubated overnight at 4 °C. Excess antibody was removed by washes in PBST and color reaction with the NBT/BCIP substrate (Roche). The stained embryos were embedded and imaged with a microscope.

Chiu C.C., Chin H.K., Chung S.Y., Hsieh K.H., Huang Y.S., Huang M.F., Lo Y.H., Wen Z.H, & Wu C.Y. (2022). Nitrobenzoate-Derived Compound X8 Impairs Vascular Development in Zebrafish. International Journal of Molecular Sciences, 23(14), 7788.

+ Open protocol

+ Expand

Whole-mount in situ Hybridization Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole-mount in situ hybridization was performed according to the method described in refs 39 (link), 40 . Probes for cpn1 were obtained through PCR by using primers listed in Table S1 and through in vitro transcription by using T7 Polymerase (Roche) with digoxigenin-labelled UTP. The probes flk, flt4, mrc1, stabilin, and ephrinb2 have been described^{18 (link), 33 (link)}. Briefly, the embryos were fixed in 4% paraformaldehyde and stored at −20 °C in methanol until use. After rehydration, permeabilization, probing with target mRNA overnight, washing, and blocking with 1% BSA, an AP-conjugated antidigoxigenin antibody was added and subsequently reacted with the NBT/BCIP substrate (Roche). The stained embryos were embedded in 3% methylcellulose and photographed using the Zeiss Axiocam HR camera (Carl Zeiss) on the Zeiss Lumar V12 stereomicroscope. For transverse sections, the embryos were fixed in the tissue freezing medium Tek OCT Compound and sectioned at 10 µm by using the Leica CM3050S cryostat and photographed on the IX71 inverted microscope (Olympus) by using the SPOT RT3 camera (Diagnostic Inc.).

Wu T.Y., Wang Y.S., Song Y.C., Chen Z.Y., Chen Y.T., Chiu C.C, & Wu C.Y. (2017). Fine-tune regulation of carboxypeptidase N1 controls vascular patterning during zebrafish development. Scientific Reports, 7, 1852.

+ Open protocol

+ Expand

Developmental Analysis of Avian Skin Appendages

Check if the same lab product or an alternative is used in the 5 most similar protocols

Early chicken embryos (E7-E11, HH31-37) and skin appendages (beak, feather with skin, scale on the leg and claw) from late stages of embryos (E12-E16, HH stage 38-42) were collected and dissected, respectively. After washing these tissues in 1x cold PBS, we fixed them in 4% paraformaldehyde in PBS at 4°C overnight. For whole-mount ISH, embryos were dehydrated through a methanol series and followed the procedures described by ^{79 (link)}. For ISH on tissue section, dissected skin appendages were dehydrated through an ethanol series, then transferred to xylene, and embedded in paraffin wax, and sectioned to 5-7μm. After ISH on the tissue section, faint eosin staining was used for counter-staining. For ISH probes, chicken β-keratins Claw9 and Chr27-FK12 were designed from a 3’UTR sequence to generate the specific signal for conserved β-keratins ^{28 (link)}. PCR primers for KTR10 are 5’-cctttggtggaggaggttcc-3’ and 5’-acggtcatcctggtgttgtc-3’(reverse) and for conserved scale keratin (SKs) are 5’-caagatgtcttgctacgacc-3’ and 5’-gtagggtctgccaaaggt-3’(reverse). cDNA from E14-feather and E16-scale were used for the DNA template. PCR product was purified with a PCR Purification Kit and then inserted into pDrive plasmid (Qiagen). T7 polymerase was used to make antisense the mRNA probe (Roche). For IHC on tissue section, AMV- 3C2 (DSHB) staining was performed as described ².

Lin G.W., Liang Y.C., Wu P., Chen C.K., Lai Y.C., Jiang T.X., Haung Y.H, & Chuong C.M. (2021). Regional specific differentiation of integumentary organs: SATB2 is involved in α- and β-keratin gene cluster switching in the chicken. Developmental dynamics : an official publication of the American Association of Anatomists, 251(9), 1490-1508.

+ Open protocol

+ Expand

Whole-mount in situ Hybridization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole-mount in situ hybridization followed the protocol based on Thisse et. al. [50 (link)]. In-situ probes were obtained by PCR amplifying about 0.5~1 kb using the primers described in the Supplemental Table S2, as well as in vitro transcription using T7 Polymerase (Roche) with a DIG-labeled RNA labeling kit (Roche). Briefly, embryos were fixed in 4% paraformaldehyde (PFA) for 16 h and switched to methanol at −20 °C. After rehydration, permeabilization with proteinase K, the probe was added to embryos in hybridization buffer at 65 °C overnight, then was washed and blocked with BSA. An AP-conjugated anti-Dig antibody was added and proceeded to react with NBT/BCIP substrate (Roche). After the reaction, embryos were embedded and photographed. For transverse sections, the embryos were fixed and embedded with Tissue-Tek O.C.T Compound (Sakura Finetek, USA), sectioned at 10 µm using a CM3050S cryostat (Leica) and photographed on an IX71 microscope (Olympus, Tokyo, Japan).

Li R.F., Wang Y.S., Lu F.I., Huang Y.S., Chiu C.C., Tai M.H, & Wu C.Y. (2022). Identification of Novel Vascular Genes Downstream of Islet2 and Nr2f1b Transcription Factors. Biomedicines, 10(6), 1261.

+ Open protocol

+ Expand

Designing ISH Probes for Chicken EDC Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

ISH probes to selected chicken EDC genes were designed from regions with a divergent sequence in the 3′UTR region. PCR primers for EDMTF4 are 5′-CTGTGAGGATCAACCCCAGT-3′ and 5′-TGTGCCTGTACCATTCATTCA-3′(reverse); for EDCH4 are 5′-GTACACCGGCTGCCTACTGT-3′ and 5′-TGGCTCATCTACATGGTTGG- 3′(reverse); for EDPE are 5′-CAAAACCCACTGGGCTAGAG-3′ and 5′-AAAACAATTAGGGCGAAGCA-3′(reverse); for EDQREP are 5′-CACCCACTCTGTCCTGGATT-3′ and 5′-TTCAGGCTTTGTTTTCCACA- 3′(reverse); for EDDM are 5′-GGATCCCTCTGCTGTGTCTC-3′ and 5′-CTCCAACCACATCAGTGCAG-3′(reverse). cDNA from E14-feathers and E16-scales were used for the DNA template. PCR products were purified with a PCR Purification Kit and then inserted into a pDrive plasmid (Qiagen, Hilden, Germany). T7 polymerase was used to make the antisense mRNA probe (Roche, Basel, Switzerland).

Lin G.W., Lai Y.C., Liang Y.C., Widelitz R.B., Wu P, & Chuong C.M. (2021). Regional Specific Differentiation of Integumentary Organs: Regulation of Gene Clusters within the Avian Epidermal Differentiation Complex and Impacts of SATB2 Overexpression. Genes, 12(8), 1291.

+ Open protocol

+ Expand

WISH Embryonic Eye Development Imaging

Check if the same lab product or an alternative is used in the 5 most similar protocols

WISH was performed as previously described (Holly et al., 2014 (link)). RNA probes were generated using PCR with T7 promoter sequence and subsequently transcribed (DIG or FITC labeled) using T7 polymerase (Roche). Primer sequences can be found in Table S2. Images were captured using a Nikon Digital sight DS-U3 camera and Elements software. Dissected eyes from 24, 32 and 48 hpf, embryos were mounted in 70% glycerol and imaged under DIC using a Nikon TiE compound microscope equipped with a 20× (0.95NA) objective and Elements software. Image adjustment was performed using Adobe Photoshop.

Pereira Piedade W., Veith S, & Famulski J.K. (2019). Ubiquitin-mediated proteasome degradation regulates optic fissure fusion. Biology Open, 8(6), bio044974.

+ Open protocol

+ Expand

Standard Histochemical Protocols for Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Standard protocols were used for Xgal histochemistry, immunofluorescence, and in situ hybridization as described previously (58 (link)). Detailed protocols are available on the Li Laboratory website (http://lilab.uchc.edu/protocols/index.html). Primary and secondary antibodies used in the study are listed in data S8. Standard in vitro transcription methods using T7 polymerase (Roche) and digoxigenin–UTP (uridine triphosphate) RNA labeling mix (Roche) were used to produce antisense riboprobes. Images were collected on a Zeiss Axio Imager M1 microscope and processed using Photoshop or Fiji software.

Khouri-Farah N., Guo Q., Morgan K., Shin J, & Li J.Y. (2022). Integrated single-cell transcriptomic and epigenetic study of cell state transition and lineage commitment in embryonic mouse cerebellum. Science Advances, 8(13), eabl9156.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!