Sybrr premix ex taqtm 2

Total RNA was extracted from the colonic samples using TRIzol (AG, Changsha, China. The Prime Script RT Reagent Kit (Takara, Dalian, China) was used to obtain cDNA, quantitative real-time polymerase chain reaction (RT-qPCR) was performed with SYBR R Premix Ex TaqTMII RT-qPCR was performed in 10 μL of assay volume containing 5 μL of SYBR Green mix (Takara), 3 μL of diethyl pyrocarbonate-treated deionized H₂O, 0.2 μL of ROX, 1 μL of the cDNA template, 0.4 μL of the forward primer, and 0.4 μL of the reverse primer. The relative amount of the target mRNA was normalized to the β-actin level, and the results were calculated by the 2^−ΔΔCt method. The primer sequences are shown in Table 3.

Total RNA was isolated from cells with TRIzol Reagent (Invitrogen, USA). The first-strand cDNA synthesis was performed using a PrimeScript^TM RT reagent kit (Takara, Japan). Real-time PCR was performed to determine relative mRNA levels using a SYBR^R Premix Ex Taq^TM II (Takara, Japan) on the LightCycler^R 96 PCR system (Roche, Switzerland). PCR cycling conditions included an initial step at 95°C for 30 s, followed by 40 cycles of 5 s at 95°C, and 30 s at 60°C. The PCR products were assessed by melting curve analysis, and gene expression levels were calculated using the ΔΔC_t method after normalization to the GAPDH housekeeping gene. All PCR samples were tested in triplicate.

Total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol. RNA (500 ng) was used for the reverse transcription reaction using the PrimeScriptTM RT Master Mix (TaKaRa Bio Technology). Real-time PCR was performed using SYBRR Premix Ex TaqTMII (TaKaRa BioTechnology) on Applied Biosystems 7300 Real Time PCR System (Applied Biosystems, Foster City, CA) according to manufacturer’s protocol. Expression of mRNA was calculated using the 2−△△Ct method and normalization with GAPDH. Primer sequences are listed below: 5’- CAAGGTCATCCATGACAACTTTG-3’ (forward) and 5’- GTCCACCACCCTGTTGCTGTAG -3’ (reverse) for GAPDH; 5’-TCATGTTGGCGAGCTATTTCC -3’ (forward) and 5’- AGGTTCCGAAGTCTCAACGAT -3’ (reverse) for JWA; 5’- ggcccaagtccagttaaaca -3’ (forward) and 5’-CAGAAAACGATGTCGCAGAA -3’ (reverse) for topoisomerase IIα.

Total RNA was isolated from lung tissue samples using TRIzol reagent (Solarbio, Beijing, China). The concentration and purity of extracted RNA were detected by spectrophotometer. The extracted RNA was reverse transcribed into cDNA using an Evo M-MLV Reverse Transcription Kit (Accurate Biology, Changsha, China). SYBRR Premix Ex TaqTM II (TaKaRa, Beijing, China) was used for quantitative real-time fluorescence analysis. The primers were synthesized by Shanghai Sangong Biological Company (Table 1). mRNA expression was calculated by the 2^−ΔΔCt method, and β-actin was the internal reference gene.

The total-RNA was extracted as explained in our recently published papers (Ali et al., 2018 (link); Khan et al., 2018 (link)). The first chain was synthesized by the Primer Script^TM Kit (TaKaRa, Dalian, China). The iQ5.0 Bio-Rad iCycler thermocycler (Bio-Rad, Hercules, CA, United States) was used for qRT-PCR, and SYBRR Premix Ex TaqTM II (TaKaRa) was used for the reaction. Pepper ubiquitin-binding gene CaUBI3 (Wan et al., 2011 (link)) and Arabidopsis Atactin2 was used as a reference. Relative gene expression levels were calculated according to the comparative threshold (2^–ΔΔCT) technique (Schmittgen and Livak, 2008 (link); Muhammad et al., 2018 (link)). All primer pairs (Supplementary Table S2) used for qRT-PCR were designed by NCBI Primer-BLAST. The expression levels were normalized and presented the mean and standard deviation (+SD) of data were obtained from three independent biological experiments with three replicates.

The primers used in RT-PCR reactions were developed by Zhang [28 (link)]. The expression level of OfACT was used as the reference [52 (link)]. The transcript levels of genes were analyzed by quantitative real-time PCR (RT-qPCR) using SYBRPremix Ex Taq II polymerase (TaKaRa, Dalian, China)and the Light Cycler 480 II Real Time System (Roche, Switzerland) according to the manufacturers’ instructions. Each 20 µL qRT-PCR reaction contained 10 µL SYBR R Premix Ex TaqTM II (Takara), 5 µL cDNA (100 ng/µL), 1.0 µL of 10 µM forward and reverse primer (designed using Primer Premier 5.0 software). The thermal cycling conditions were as follows: an initial denaturation of 30 s at 95 °C, followed by 40 cycles at 95 °C for 5 s and 60 °C for 30 s; then 95 °C for 5 s, 60 °C for 1 min and 95 °C for 15 s was used for dissociation curve analysis. The relative expression levels were calculated using 2-ΔCt [53 (link)]. Each statistical analysis was performed using IBM SPSS Statistics 19.0 (IBM, Armonk, NY, USA). The data were analyzed using a Tukey’s multiple-range test (P < 0.05) with three replicates.