Fastprep 24tm homogenizer

Approximately 50 mg of liver or intestinal scrapings were transferred into prefilled Lysis Matrix D micro-centrifuge tubes (MP Biomedicals, UK) containing 500 µl of Ribozol (Amresco LLC, Ohio, USA). The tissue was homogenized for 60 seconds at 6.0 m/s on a Fastprep-24^TM homogenizer (MP Biomedicals, UK) and total RNA was isolated in accordance with the manufacturer’s instructions (Ribozol, Amresco LLC, Ohio, USA). Total RNA (1 µg) was reverse transcribed into cDNA using the High Capacity cDNA reverse transcription Kit (Life Technologies, Paisley, UK) in accordance with the manufacturer’s instructions and real-time quantitative polymerase chain reaction (RT-qPCR) was performed on 10 ng cDNA using the iTag Universal SYBR Green SuperMix (Bio-Rad, Hertfordshire, UK) and 50 nM of each gene-specific oligonucleotide primer (See Supplementary Table S2): Initial melting (95 °C for 5 minutes) followed by 40 cycles of melting (94 °C for 15 seconds), annealing (60 °C for 15 seconds) and extension (72 °C for 30 seconds) was performed using a CFX Connect^TM Real-Time Instrument (Bio-Rad). Transcript levels in the HFD + P group were determined using 2^{−(ΔCt1–ΔCt2)}, where ΔCt represents the difference between the Ct for each target gene and β-Actin mRNA transcript levels and are expressed as a ratio of expression relative to the HFD group.

Genomic DNA was extracted from 200 mg stomached fecal material (stomacher 2x 60 sec at mid speed) using the Power Soil Kit protocol (MoBio Laboratories). The FastPrep bead-beating step was performed in 3 cycles of 15 s each at a speed of 6.5 M/s in a FastPrep-24TM Homogenizer (MP). DNA quantity and quality were measured using a NanoDrop 1000 (Thermo Scientific), 16S rRNA gene library preparation. The fecal microbiota composition was determined using tag-encoded 16S rRNA gene MiSeq-based (Illumina, CA, USA) high throughput sequencing. In brief the V3 region of the 16S rRNA gene was amplified using primers compatible with the Nextera Index Kit (Illumina) NXt_338_F:5′- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGACWCCTACGGGWGGCAGCAG -3′ and NXt_518_R: 5′- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGATTACCGCGGCTGCTGG -3^′.. [20 (link)]; the PCR reactions and library preparation were conducted as described in [21 (link)].

One ml of fecal slurry (inoculum) (see above) and sample material after at 24 h of fermentation were pelleted via centrifugation at 13.000 g for 10 min and gDNA was extracted from the pellet using the Power Soil Kit protocol (MoBio Laboratories, Carlsbad, CA, USA). The FastPrep bead-beating step was performed in 3 cycles of 15 s each at a speed of 6.5 M/s in a FastPrep-24TM Homogenizer (MP). DNA quantity and quality were measured using a NanoDrop 1000 (Thermo Scientific, Waltham, MA, USA).