Androgen receptor

2.5×10⁶ LNCaP cells were treated with 0.05% ethanol or 5 nM R1881 overnight and fixed in 1% formaldehyde for chromatin immunoprecipitation using the Millipore EZ-ChIP Chromatin Immunoprecipitation Kit protocol (Cat. No. 17-371). For end-point PCR, 2 μl of purified DNA was used for thermocycling: initial denaturing at 94°C for 3 minutes, followed by 33 cycles of 20 seconds 94°C denaturing, 30 seconds 52°C annealing, 30 seconds 72°C extension, and a single final 72°C 2 minute extension step. Products were run at 90 volts on a 2% agarose TBE gel and stained with SYBR Safe DNA Gel Stain. For qPCR, 1.5 μl of purified DNA was used per reaction. For ChIP qPCR reactions, SEMA3C intron 2 ARE primer sequences: 5′- aaatgccggtactggcctta (forward), 5′- gcttaaaggtcacaagattg (reverse); PCR primers amplify a 150 bp genomic region containing the SEMA3C intron 2 ARE. GAPDH primers were provided with the Millipore EZ-ChIP Chromatin Immunoprecipitation Kit. SEMA3C levels were quantitated using a ΔΔCt method, normalized first to input and then isotype control. Antibodies for immunoprecipitation: Androgen Receptor (Santa Cruz Biotechnology, Cat. No. sc-816), GATA-2 (Santa Cruz Biotechnology, Cat. No. sc-9008), and N-cadherin (isotype control, Santa Cruz Biotechnology, Cat. No. sc-7939).

Whole cell extracts were prepared in 50 mM Tris-HCl, 150 mM NaCl, 1% NP40, 10 mM NaF, 10% Glycerol, supplemented with protease inhibitor cocktail (Roche, Cat. No. 04693116001) and quantitated using a BCA approach. 60 μg of protein, or 40 μl of conditioned media, was run on 10% acrylamide gels and transferred onto nitrocellulose membrane. Western blots were imaged on radiography film or by a LI-COR Odyssey system. actin or vinculin served as loading controls. Primary antibodies: phospho-Akt (Ser473; Cell Signaling Technology, Cat. No. 4060S), pan-Akt, (Life Technologies, Cat. No. 44609G), androgen receptor (Santa Cruz Biotechnology, Cat. No. sc-816), SEMA3C (Santa Cruz Biotechnology, Cat. No. sc-27796), GATA2 (Santa Cruz Biotechnology, Cat. No. sc-9008), FOXA1 (Santa Cruz Biotechnology, Cat. No. sc-6553), POU2F1 (Santa Cruz Biotechnology, Cat. No.s sc-232, sc-8024; Cell Signaling Technology, Cat. No. 4428S), actin (Sigma-Aldrich, Cat. No. A2066), and vinculin (Sigma-Aldrich, Cat. No. V4505). Secondary antibodies: anti-rabbit alexa fluor 680 (Invitrogen, Cat. No. A21109), anti-mouse alexa fluor 680 (Invitrogen, Cat. No. A21058), anti-goat alexa fluor 680 (Invitrogen, Cat. No. A21084), anti-rabbit HRP (Dako, Cat. No. P0448), anti-mouse HRP (Dako, Cat. No. P0447), and anti-goat HRP (Dako, Cat. No. P0160).

Mice were sacrificed by CO₂ asphyxiation at defined time points. Tumor tissue as well as pieces of liver, kidney, spleen and lung tissue was fixed in 10% buffered formalin overnight. Lungs were also inflated with 10% buffered formalin prior to overnight fixation. All tissues were examined by routine light microscopy after hematoxylin and eosin (H&E) staining. For antigen retrieval, slides were boiled for 10 minutes in 10mM sodium citrate pH 6 solution for all antibodies. Primary antibodies were incubated at the following dilutions: Androgen Receptor (Santa Cruz N20; 1:200) was applied according cell signaling protocol. ImmPRESSTM detection system (Vector Laboratories) was used for all antibodies. Staining was visualized using 3,3′- Diaminobenzidine (DAB) (Sigma, Saint Louis, MO, FAST 3,3′-Diamino benzidine) and slides were counterstained with hematoxylin. For assessment by necropsy and histopathology in intact and castrated animals, sample size was at least 10 animals per group.

Testes placed in lysis buffer containing RIPA buffer and protease inhibitor cocktails were dispersed with homogenizers (Thermo Fisher Scientific, USA) on ice. Then the lysates were centrifuged at 12,000 × g, 10 min, 4°C, and the supernatant containing testicular proteins were stored immediately at -80°C until later use. Protein concentrations were determined by using the BCA^TM Protein Assay Kit (Thermo Fisher Scientific, USA).
SDS-PAGE was conducted on 30 μg testicular protein per well using 10% denaturing polyacrylamide gels and then proteins were electrotransferred to PVDF membranes, using a semi-dry transfer apparatus [22 (link)]. Membranes were blocked for 1 h at room temperature with 5% bovine serum albumin (BSA) and immunoblotting was performed overnight at 4°C with one of the following antibodies: occludin (Invitrogen, 1:1000), ZO-1 (Invitrogen, 1:1000), androgen receptor (Santa Cruz, 1:500), clatherin (Invitrogen, 1:1000), followed by incubation with secondary antibody conjugated to HRP at a 1:8000 dilution. After washing with Tris-buffered saline (TBS), signals were detected by enhanced chemiluminescence according to the manufacturers’ instructions. Meanwhile, β-actin served as the internal control. Western blot was repeated at least three times for each sample from three HFD and CD mice, respectively.