RNA was extracted from cells with Trizol (Life Technologies) and DNase treated using RNeasy columns (Qiagen). Expression of mRNA levels for PIK3IP1 (Fwd 5’-GCTAGGAGGAACTACCACTTTG-3’ and Rev 5’-GATGGACAAGGAGCACTGTTA-3’), EZH2 ORF (Fwd 5’-GACGGCTTCCCAATAACAGTA-3’ and Rev 5’-AGTGCCAATGAGGACTCTAAA-3’), and EZH2 3’UTR (Fwd 5’-AATCCCTTGACCTCTGAAAC-3’ and Rev 5’-ACTGGTACAAAACACTTTGC-3’) was determined using SYBR green iScript (Bio-Rad) master mix on a Bio-Rad Chromo4 machine. β-2-microglobulin was used as an internal control.
Chromo4 machine
Manufactured by Bio-Rad
Sourced in United Kingdom
The Chromo4 machine is a real-time PCR detection system designed for quantitative and qualitative nucleic acid analysis. It features four independent thermal cyclers and a sensitive optical detection system for monitoring fluorescent signals during PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy column, by Qiagen (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Total nucleic acid kit, by Roche (1 mentions)
Itaq universal sybr green supermix, by Bio-Rad (1 mentions)
Platinum quantitative rt pcr thermoscript one step system, by Thermo Fisher Scientific (1 mentions)
Taqman assay, by Thermo Fisher Scientific (1 mentions)
Spin column, by Qiagen (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Express qpcr supermix, by Thermo Fisher Scientific (1 mentions)
Nanodrop, by Thermo Fisher Scientific (1 mentions)
6 protocols using chromo4 machine
1
Quantification of PIK3IP1, EZH2 mRNA
2
Quantification of Viral RNA in Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify the relative amount of viral RNA in the respective tissues, viral RNA was extracted from the heart, liver, spleen, lung, kidney, and brain samples using the automated Magna Pure method and a Total Nucleic Acid Kit (Roche Diagnostics), following the manufacturer’s instructions. CHIKV RNA was detected with specific TaqMan probes by using one-step RT-PCR (Master RNA hybridization probes, Roche), performed on a Chromo 4 machine (Bio-Rad). The primers and probes used for CHIKV RNA quantification were CHIKV-forw AAGCTCCGCGTCCTTTACCAAG; CHIKV-rev CCAAATTGTCCTGGTCTTCCT; and Probe: Fam-CCAATGTCTTCAGCCTGGACACCTTT-BHQ1 (29 (link)). For absolute quantification, standard curves were generated using 10-fold dilutions of CHIKV Ross RNA templates of known concentration (tittered in Vero cells by TCID50). Based on repeated standard curves, the formula was obtained: y=-3.641x+31.76 (y means CT, x means index). The extracted viral RNA from tissues were used to obtain the CT number using qRT-PCR. Weight of each tissue was measured prior to extraction. From these known data, the results were calculated and expressed as TCID50 per gram of tissue (30 (link)).
3
Quantitative RT-PCR Assay for Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells using TRIzol (Thermo Fisher Scientific) and DNase treated using RNeasy columns (QIAGEN). Expression of mRNA levels for IL6, IL8, IL1β, and HMGB2 (Taqman primers from Invitrogen) was determined using Platinum Quantitative RT-PCR ThermoScript One-Step System (Invitrogen) master mix on a Chromo4 machine (Bio-Rad Laboratories). β-2-microglobulin (B2M; Taqman) was used as an internal control. Expression of all other RNAs was determined using iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories) master mix. B2M was used as an internal control. Primer sequences can be found in Table S1. All qRT-PCR data were normalized to B2M, and fold change was calculated using the ΔΔC(t) method.
4
Quantitative PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using a spin column (Qiagen, Manchester, UK), and random-primed complementary DNA was prepared using Superscript III (Life Technologies). Real-time polymerase chain reaction was performed on a Chromo4 machine (BioRad, Herts, UK) using Express qPCR supermix (Life Technologies) and Taqman assays (Life Technologies; Supplemental Table 1 ). Expression was normalized against 18S, TBP, PGK, β2M, POL2RA, HPRT, ACTB, and/or GAPDH; data shown are 18S normalized unless indicated otherwise. Analysis of published microarray data (32 (link)) was performed using R software (https://www.r-project.org/ ) or Microsoft Excel. Genes whose expression correlated significantly with that of VDR (204255_s_at) were identified using a lymphoma data set (33 (link)) and compared with the previously identified stroma gene signature stromal 1 (33 (link)).
5
Quantification of PIK3IP1, EZH2 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from cells with Trizol (Life Technologies) and DNase treated using RNeasy columns (Qiagen). Expression of mRNA levels for PIK3IP1 (Fwd 5’-GCTAGGAGGAACTACCACTTTG-3’ and Rev 5’-GATGGACAAGGAGCACTGTTA-3’), EZH2 ORF (Fwd 5’-GACGGCTTCCCAATAACAGTA-3’ and Rev 5’-AGTGCCAATGAGGACTCTAAA-3’), and EZH2 3’UTR (Fwd 5’-AATCCCTTGACCTCTGAAAC-3’ and Rev 5’-ACTGGTACAAAACACTTTGC-3’) was determined using SYBR green iScript (Bio-Rad) master mix on a Bio-Rad Chromo4 machine. β-2-microglobulin was used as an internal control.
6
Quantifying rDNA Copy Number in Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used qPCR to determine the relative number of rDNA copies in the mutants vs the wildtype strain. Each strain was grown in 10 ml YEPD at 30°C to early stationary phase, and DNA was extracted (Hoffman and Winston 1987 (link)). DNA concentration was estimated by Nanodrop (ThermoFisher) and fine-tuned by measuring band intensity on gels. The change in rDNA copy number in MSS2 and MLS7 relative to YJ0 was assessed (Supplementary File S1) with the ΔΔCt method as modified by Pfaffl (2001) (link) to allow for different amplification efficiencies between reference and target gene. As target we used a section of SSU rDNA, amplified with primers Y-SSUqF2 and Y-SSUqR2, for an amplicon size of 102 bp. As reference, we used the single-copy ACT1 gene, amplified with primers Y-Act1qF4 and Y-Act1qR4, for an amplicon size of 87 bp. In each of two replicate qPCR experiments, each DNA was tested in triplicate with the SSU primers and with the ACT1 primers. Standard SybrGreen qPCR reactions were run in 96-well plates in a Bio-Rad Chromo 4 machine, with Opticon Monitor software version 3.1. Cycling conditions are in Table 2 (column F). Amplification efficiencies, 1.55 for SSU and 1.47 for ACT1, were calculated by the Opticon Monitor software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!