Trizol method

Total RNA was extracted from cells and animal tissues by the Trizol method (Sigma, China). For determining the tissue specificity of Lcn2 gene expression, kidney, pancreas, heart, lung, spleen, liver, jejunum, colon, adipose, bone, muscle, testis, and brain were collected for RNA extraction. Reverse transcription was performed on 2 μg of RNA using random hexamers and reverse transcriptase (Thermo-Fisher Scientific, USA). Quantitative real-time PCR was performed using the FastStart Universal SYBR Green Master fluorescence quantitative kit (Roche, Switzerland). All data were normalized to a housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or β-actin measured in the same sample. The sequences of the specific primers are listed in Table 1. The fold change was calculated using ΔΔ threshold cycle method.

Total RNA was isolated from 200 adult fly heads using standard Trizol method (Sigma) from adult fly heads of GMR-GAL4 driven UAS-mahe and GMR-GAL4 alone which served as control for comparison. Libraries were made using standard protocol of TrueSeq RNA sample Prep kit v2. Libraries were then sequenced by the paired-end reads using Illumina HiSeq2500 platform and the resulting sequencing reads were aligned to the reference Drosophila melanogaster genome downloaded from Ensemble database (ftp://ftp.ensembl.org/pub/release-81/fasta/drosophila_melanogaster/dna/Drosophila_melanogaster.BDGP6.dna.toplevel.fa.gz). The alignment was performed by STAR program (version = STAR_2.4.1d). Further, the aligned reads were used for estimating expression of transcripts using cufflinks program (version: cufflinks-2.2.1). The expression values are reported in FPKM (Fragment per kilo per million) units for each of the genes and transcripts. Differential expression analysis was performed using cuffdiffv2.2.1. Gene ontology analysis was done using DAVID 6.8 (The Database for Annotation, Visualization and Integrated Discovery).

For gene expression analysis in An. stephensi, total RNA was extracted from mosquitoes 24 hpi utilizing the TRIzol method (Sigma-Aldrich, China). Reverse transcription and quantitative PCR were performed as previously described [43 (link)]. The expression levels of target genes were normalized by the An. stephensi ribosomal gene S7. For detection of the abundance of gut microbiota, three midguts were pooled for DNA extraction. The levels of 16S rRNA gene were determined by quantitative PCR. The primers used for this study are listed in S2 Table.

Real time PCR was performed to study the expression level of ahpC and ohr after 15 min and 1 h of treatment with the conditions. RNA was purified using the trizol method (Sigma–Aldrich) followed by cDNA synthesis using Reverse Transcriptase (RT) Enzyme (Thermo Scientific). The reaction mixture for cDNA synthesis was as follows: 4 μg RNA template, 1U RT enzyme, 1X RT buffer, 2 mM dNTP’s, 0.2 μg Random primers, water to make the volume upto 20 μL. After completion of the reaction cycle, comprising of the following steps: 25°C for 10 min, 50°C for 1 h and a final extension of 70°C for 10 min, the mixture was diluted to obtain a final cDNA concentration of 100 ng/μL. The expression levels of both the genes were measured using 100 ng of cDNA template with 0.5 μM each of the specific primers (ahpC Forward primer: 5′CCACTGGAAGTGGACGAACT3′ ahpC Reverse primer: 5′TTCTGGCCCAAGGACTTCAC3′; ohr Forward primer: 5′ GGATGGTGACGTTGAGACG 3′ ohr Reverse primer: 5′ CCAAACACAACGTGAAGCTG 3′) with 1X SYBR green in Illumina Real-time PCR. The 2^-ΔΔC_T method was used for analysis where 16s rRNA was used as the house keeping gene, followed by normalization with the untreated sample (t = 0 min).