Nextera adapter

The fungi-specific primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns, 1993 (link)) and ITS2 (GCTGCGTTCTTCATCGATGC) (White et al., 1990 (link)) were selected to target the ITS1 region. These primer pairs were modified for pyrosequencing by adding the forward Illumina Nextera adapter, a two-base-pair “linker” sequence, and a unique 7-bp barcode sequence to the 5′ end of the forward primer and the appropriate reverse Illumina Nextera adapter and linker sequence at the 5′ end of the reverse primer. PCR amplification was performed in a 25 μl reaction: 2.5 μl of 10 × reaction buffer, 10 μM of each primer, 2.5 mM dNTPs, 40 ng of template, and 0.625 units of Takara Pyrobest (Takara Biotechnology Co., Ltd., Japan). Amplifications were performed with the following temperature regime: 4 min of initial denaturation at 94°C, followed by 35 cycles of denaturation (94°C for 30 s), annealing (50°C for 45 s), extension (72°C for 1 min), and a final extension at 72°C for 7 min. The PCR products were purified using a PCR Purification Kit (Axygen Bio, USA). Then, paired-end sequencing was performed on an Illumina MiSeq sequencer at Personal Biotechnology Co., Ltd (Shanghai, China).

Amplification of the microbial 16S rRNA V4 gene region from the extracted gDNA was performed using OneTaq 2x Master Mix (NEB, Ipswich, MA, USA). Primer pair 515F-806R containing partial Illumina Nextera adapter in their 5′ end was used to amplify the 16S V4 region (Walters et al., 2015 (link)). The polymerase chain reaction (PCR) amplification profile was as follows; Initial denaturation: 94 °C for 30 s, followed by 35 cycles of denaturation (94 °C for 15 s), annealing (48 °C for 15 s) and extension (68 °C for 30 s). The PCR products were bead-purified and subsequently indexed to incorporate dual-index barcode and Illumina adapter. The indexed PCR products were pooled, purified, and measured using Denovix high-sensitivity fluorescence quantification kit (Denovix, Wilmington, DE, USA). Single-end sequencing (300 bp × 1) was performed on Illumina iSeq 100 platform (Illumina, San Diego, CA, USA) by GeneSEQ Sdn. Bhd. (Malaysia).

Total genomic DNA extractions were sent to and sequenced at the Australian Genome Research Facility (AGRF Ltd, Brisbane, Australia). All samples were sequenced at the same time and given anonymised acronyms (sample names did not contain location information) to eliminate technical bias. Both EBCs and one negative amplification control were included in the sequencing effort. Amplicon sequencing libraries were prepared for the Illumina MiSeq system using the 16S Metagenomic Sequencing Library Preparation guideline document, with all samples sequenced in a single Miseq run with lane number being randomised across samples. Briefly, a two-stage PCR process was used to amplify the primary product with an Illumina Nextera-adapter, with a secondary PCR to add the index on to the adapter. Two hypervariable regions (V3 and V4) of the 16S rRNA gene were amplified using the following primers: 341F (5′-CCTAYGGGRBGCASCAG-3′) and 806R (5′-GGACTACNNGGGTATCTAAT-3′). To discriminate individual koala samples after sequencing, both forward and reverse primers were labelled at the 5’ end with a combination of two different 8 bp tags (i.e. Nextera index strategy). The resulting 16S rRNA amplicons were measured by fluorometry (Invitrogen Picogreen), pooled at equimolar concentrations and sequenced on the MiSeq platform with the 300 bp paired end read chemistry.