Sybr green pcr system

Manufactured by Bio-Rad

Sourced in United States

The SYBR Green PCR system is a real-time PCR (polymerase chain reaction) solution designed for gene expression analysis and DNA quantification. The system utilizes the SYBR Green I dye, which binds to double-stranded DNA, enabling the monitoring of DNA amplification in real-time. The system provides a reliable and sensitive platform for various nucleic acid detection and quantification applications.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

SYBR Green (1276 citations) SYBR Green system (33 citations)

11 protocols using sybr green pcr system

Quantifying Gene Expression in PBLs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was extracted from peripheral blood cells (PBLs) from each patient following the clinical trial, using a Nucleo Spin RNA kit (Macherey-Nagel, Düren, Germany). One microgram of total RNA was reverse-transcribed in a final volume of 20 μl with the First Strand cDNA Synthesis Kit (Roche, Mannheim, Germany) using random primers. The SYBR Green PCR system (BioRad, Hercules, CA, USA) was used to perform real-time PCR with an iQ5 system (Biorad, Spain). The sequences of the oligonucleotides used corresponded to the following shown in Table 1:Table 1

Primers used for qPCR amplications

GENE	Forward	Reverse
18S	5′- CTCAACACGGGAAACCTCAC - 3′	5′-CGCTCCACCAACTAAGAACG - 3′.
BAX	5′- CACTCCCGCCACAAAGAT - 3′	5′- CAAGACCAGGGTGGTTGG - 3′
EPO	5′ - TGTTTTCGCACCTACCATCA - 3′	5′ - AAGTCACAGCTTGCCACCT - 3′
SOX2	5′ – GGGGGAATGGACCTTGTATAG - 3′	5′ – CGCTCCACCAACTAAGAACG - 3′
OCT4	5′- CTTCGGATTTCGTCTTCTCG-3′	5′- CTTAGCCAGGTCCGAGGAT - 3′

As an internal control, mRNA levels of 18S were measured. Amplicons were detected using an iQ5 system (BioRad). The samples were assessed in triplicate and the experiment was repeated twice.

Albiñana V., Escribano R.M., Soler I., Padial L.R., Recio-Poveda L., Villar Gómez de las Heras K, & Botella L.M. (2017). Repurposing propranolol as a drug for the treatment of retinal haemangioblastomas in von Hippel-Lindau disease. Orphanet Journal of Rare Diseases, 12, 122.

+ Open protocol

+ Expand

Quantifying Adipogenic Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from ASCs using Trizol reagent and RNA concentration was determined by Nanodrop (Nano Drop 2000, Thermo Scientific). The cDNA was obtained by reverse transcription containing 1 μg of total RNA, oligo (dT), and reverse transcription premix. The qRT-PCR reactions were performed with the SYBR green PCR system (CFX96, Bio-Rad) in a thermal cycler (C1000, Bio-Rad). The cycling conditions were as follows: 95°C for 10 min; followed by 40 cycles involving denaturing at 95 °C for 5 s, annealing at 60 °C for 15 s, and extension at 72 °C for 10 s. Expression of mRNAs was normalized by the mRNA levels of GAPDH. The following forward and reverse primer sequences were used: C/EBPα, 5′-GCAAACTCACCGCTCCAATG-3′,5′-CTTCTCTCATGGGGGTCTGC-3′; PPARγ:5′-AGGTCAGCGGACTCTGGATTC-3′,5′-AGTGGGGATGTCTCATAATG-3′; aP2, 5′-ATGGGGGTGTCCTGGTACAT-3′, 5′-ACGTCCCTTGGCTTATGCTC-3′; LPL: 5′-CGAGCGCTCCATTCATCTCT-3′, 5′-CCAGATTGTTGCAGCGGTTC-3′; FAS, 5′-AAGGACCTGTCTAGGTTTGATGC-3′, 5′-TGGCTTCATAGGTGACTTCCA-3′, ACC, 5′-CTTGAGGGCTAGGTCTTTCTGG-3′, 5′-CTGGTTCAGCTCCAGAGGTT-3′, SREBP-1c, 5′-GCCCCTGTAACGACCACTG-3′, 5′-CAGCGAGTCTGCCTTGATG-3′, GAPDH, 5′-GAGTCAACGGATTTGGTCGT-3′,5′-TTGATTTTGGAGGGATCTCG-3′.

Park I.S., Kim B., Han Y., Yang H., Cho U., Kim S.I., Kim J.H., Yoon Park J.H., Lee K.W, & Song Y.S. (2019). Decursin and Decursinol Angelate Suppress Adipogenesis through Activation of β-catenin Signaling Pathway in Human Visceral Adipose-Derived Stem Cells. Nutrients, 12(1), 13.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from AML12 cells using TRIzol^® reagent (Thermo Fisher Scientific, Inc.). Total RNA was reverse transcribed into cDNA using a SuperScript^™ IV First-Strand Synthesis system (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturers' protocol. qPCR was subsequently performed using the SYBR Green PCR system and SYBR Green reagents (Bio-Rad Laboratories, Inc.) in an ABI 7500 thermal cycler (Applied Biosystems; Thermo Fisher Scientific, Inc.). The following thermocycling conditions were used for qPCR: Initial denaturation at 95˚C for 3 min, followed by 40 cycles of denaturation at 95˚C for 10 sec, annealing at 60˚C for 5 sec and extension at 72˚C for 10 sec. The sequences of the primers were as follows: NRF1 forward, 5'-CGCAGCACCTTTGGAGAA-3' and reverse, 5'-CCCGACCTGTGGAATACTTG-3'; TFAM forward, 5'-GGAATGTGGAGCGTGCTAAA-3' and reverse, 5'-TGCTGGAAAAACACTTCGGAATA-3'; TNF-α forward, 5'-CGTGCTCCTCACCCACAC-3' and reverse, 5'-GGGTTCATACCAGGGTTTGA-3'; IL-6 forward, 5'-ACAACCACGGCCTTCCCTACTT-3' and reverse, 5'-GTGTAATTAAGCCTCCGACT-3'; IL-1β forward, 5'-TCCAGGATGAGGACATGAGCAC-3' and reverse, 5'-GAACGTCACACACCAGCAGGTA-3' and GAPDH forward, 5'-TCACCACCATGGAGAAGGC-3' and reverse, 5'-GCTAAGCAGTTGGTGGTGCA-3'. GAPDH was used for normalization of mRNA levels. Relative mRNA expression levels were calculated using the 2^-ΔΔCq method (17 (link)).

Shi W., An L., Zhang J, & Li J. (2021). Periplaneta americana extract ameliorates lipopolysaccharide-induced liver injury by improving mitochondrial dysfunction via the AMPK/PGC-1α signaling pathway. Experimental and Therapeutic Medicine, 22(4), 1138.

+ Open protocol

+ Expand

Comprehensive RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from adipose tissues and hypothalamus using TRIzol reagent (TransGen Biotech). Quantification and integrity analysis of total RNA was performed by running 1 µl of each sample on NanoDrop 5500 (Thermo). The cDNA was prepared by reverse transcription (TransScript one-step gDNA removel and cDNA synthesis Super MiX, TransGen Biotech). The relative expression of mRNAs was determined by the SYBR Green PCR system (Bio-Rad). The relative expression of genes of interest was calculated by comparative Ct method and GAPDH was used as an endogenous control. GAPDH RNA was chosen as the housekeeping gene. Sequences of the primers used for real-time qPCR are available in Table S2: Primers used in the present study.

Zhao M., Wang B., Zhang C., Su Z., Guo B., Zhao Y, & Zheng R. (2021). The DJ1-Nrf2-STING axis mediates the neuroprotective effects of Withaferin A in Parkinson’s disease. Cell Death and Differentiation, 28(8), 2517-2535.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of HB Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from HB cells using Nucleo Spin RNA kit (Macherey-Nagel, Düren, Germany). One microgram of total RNA was reverse-transcribed in a final volume of 20 μl with the First Strand cDNA Synthesis Kit (Roche, Mannheim, Germany) using random primers. SYBR Green PCR system (BioRad, Hercules, CA, US) was used to carry out real-time PCR with an iQ5 system. Primers used for qPCR are: 18S Fwd: 5′-CTCAACACGGGAAACCTCAC-3′, 18S Rv: 5′-CGCTCCACCAACTAAGAACG-3′; BAX Fwd: 5′-CACTCCCGCCACAAAGAT-3′, BAX Rv: 5′-CAAGACCAGGGTGGTTGG-3′, CASP9 Fwd: 5′-CCCAAGCTCTTTTTCATCCA-3′, CASP9 Rv: 5′-TTACTGCCAGGGGACTCGT-3′, AQP1 Fwd: 5′-CCTCCCTGACTGGGAACTC-3′, AQP1 Rv: 5′-GGAGGGTCCCGATGATCT-3′.

Cuesta A.M., Albiñana V., Gallardo-Vara E., Recio-Poveda L., de Rojas-P I., de Las Heras K.V., Aguirre D.T, & Botella L.M. (2019). The β2-adrenergic receptor antagonist ICI-118,551 blocks the constitutively activated HIF signalling in hemangioblastomas from von Hippel-Lindau disease. Scientific Reports, 9, 10062.

+ Open protocol

+ Expand

Valve Cell Phenotype Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Valve cell phenotype was assessed at both the gene and protein level (see the Supplemental Experimental Procedures for additional details). Briefly, gene expression was measured by extracting RNA using a QIAGEN total RNA purification kit (QIAGEN) and reverse transcribed to cDNA using the SuperScript III RT-PCR kit with oligo(dT) primer (Invitrogen). Samples were amplified using the SYBR Green PCR system (Bio-Rad) on a Bio-Rad CFX96 cycler. For visualization of proteins, collagen constructs were fixed in 4% PFA overnight at 4°C. Cells were incubated overnight with the appropriate primary/secondary antibodies, washed, and nuclear counterstained for subsequent confocal imaging. For quantification of protein expression, cells were trypsinized from the collagen constructs, fixed with 4% PFA for 10 min, and then preserved in 50% methanol/PBS. Cells were further washed and incubated with appropriate primary/secondary antibodies and scanned using a Coulter Epics XL-MCL Flow Cytometer (Coulter). Adhesion testing assay methods are included in the Supplemental Experimental Procedures.

Gould R.A., Yalcin H.C., MacKay J.L., Sauls K., Norris R., Kumar S, & Butcher J.T. (2015). Cyclic Mechanical Loading Is Essential for Rac1-Mediated Elongation and Remodeling of the Embryonic Mitral Valve. Current biology : CB, 26(1), 27-37.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of vASCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA of vASCs was extracted using Trizol reagent and RNA concentration was determined using Nanodrop (Nano Drip 2000, Thermo Scientific). cDNA was obtained using reverse transcription containing 1 μg of total RNA, oligo (dT), and reverse transcription premix. The qRT-PCR reactions were performed using the SYBR green PCR system (CFX96, Bio-Rad) in a thermal cycler (C1000, Bio-Rad). The cycling conditions were as follows: 95 °C for 10 min followed by 38 cycles involving denaturing at 95 °C for 5 s, annealing at 60 °C for 15 s, and an extension at 72 °C for 10 s. Expression of mRNAs were normalized to the mRNA levels of GAPDH. The forward and reverse primer sequences are listed in Table 2.

Park I.S., Han Y., Jo H., Lee K.W, & Song Y.S. (2021). Piceatannol Is Superior to Resveratrol at Suppressing Adipogenesis in Human Visceral Adipose-Derived Stem Cells. Plants, 10(2), 366.

+ Open protocol

+ Expand

RNA Extraction and Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA extractions were performed using a Qiagen total RNA purification kit (Qiagen, Valencia, CA) and RNA was reverse transcribed to cDNA using the SuperScript III RT-PCR kit with oligo(dT) primer (Invitrogen). Sufficient quality RNA was determined by an absorbance ratio A260/A280 of 1.8–2.1, while the quantity of RNA was determined by measuring the absorbance at 260nm (A260). Real-time PCR experiments were conducted using the SYBR Green PCR system (Biorad, Hercules, CA) on a Biorad CFX96 cycler, with 40 cycles per sample. Cycling temperatures were as follows: denaturing, 95C; annealing, 60C; and extension, 70C. Primers were designed to detect GAPDH, E-cadherin, vimentin, Slug, Sp1, and NFATc1 in cDNA clones: Sp1 (F-TTG AAA AAG GAG TTG GTG GC, R-TGC TGG TTC TGT AAG TTG GG, Accession NG030361.1), NFATc1 (F-GCA TCA CAG GGA AGA CCG TGT C, R-GAA GTT CAA TGT CGG AGT TTC TGA G, Accession NG029226.1). GAPDH, E-cadherin, vimentin, and Slug primers were taken from previously published literature [7 (link)].

Gould R., Bassen D.M., Chakrabarti A., Varner J.D, & Butcher J. (2016). Population Heterogeneity in the Epithelial to Mesenchymal Transition Is Controlled by NFAT and Phosphorylated Sp1. PLoS Computational Biology, 12(12), e1005251.

+ Open protocol

+ Expand

Gene Expression Analysis of Hemangioblastoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was extracted from hemangioblastoma cells using a Nucleo Spin RNA kit (Macherey-Nagel, Düren, Germany). One microgram of total RNA was reverse-transcribed in a final volume of 20 μl with the First Strand cDNA Synthesis Kit (Roche, Mannheim, Germany) using random primers. SYBR Green PCR system (BioRad, Hercules, CA, USA) was used to carry out real-time PCR with an iQ5 system. The sequences of the oligonucleotides used corresponded to HIF-1α and -2α target genes, as follows: VEGF forward: 5’-ATCTGAGCAGGGCGACAGC-3’ and reverse 5’-ACTCCCTGTGGTGCAGTCA-3’; EPO forward 5’-TGTTTTCGCACCTACCATCA-3’ and reverse 5’-AAGTCACAGCTTGCCACCT-3’; and SOX2 forward 5’-GGGGGAATGGACCTTGTATAG-3’ and reverse 5’-CGCTCCACCAACTAAGAACG-3’. As an internal control, mRNA levels of 18S were measured using the following primers: forward 5’-CTCAACACGGGAAACCTCAC-3’ and reverse 5’-CGCTCCACCAACTAAGAACG-3’. Amplicons were detected using an iQ5 system (BioRad). The samples were used in triplicate and the experiment was repeated twice.

Albiñana V., Villar Gómez de las Heras K., Serrano-Heras G., Segura T., Perona-Moratalla A.B., Mota-Pérez M., de Campos J.M, & Botella L.M. (2015). Propranolol reduces viability and induces apoptosis in hemangioblastoma cells from von Hippel-Lindau patients. Orphanet Journal of Rare Diseases, 10, 118.

+ Open protocol

+ Expand

Quantitative Analysis of ACVRL1/ALK1 and ENG Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

For quantitative analysis of ACVRL1/ALK1 and ENG transcripts, total RNA was reverse-transcribed using the Reverse Transcriptase AMV cDNA Synthesis kit (Roche). The resulting cDNA was used as a template for real-time PCR performed using the SYBR Green PCR system (BioRad), with the following primers. ACVRL1/ALK1: Fwd 5′-ATCTGAGCAGGGCGACAGC-3′ and Rev 5′-ACTCCCTGTGGTGCAGTCA-3′; ENG Fwd 5′-GCCCCGAGAGGTGCTTCT-3′ and Rev 5′-TGCAGGAAGACACTGCTGTTTAC-3′. As an internal control, mRNA levels of 18S were measured using these primers: Fwd 5′-CTCAACACGGGAAACCTCAC-3′ and Rev 5′-CGCTCCACCAACTAAGAACG-3′. Amplicons were detected using an iQ5 system (BioRad). Each experiment was performed in triplicates.

Albiñana V., Zafra M.P., Colau J., Zarrabeitia R., Recio-Poveda L., Olavarrieta L., Pérez-Pérez J, & Botella L.M. (2017). Mutation affecting the proximal promoter of Endoglin as the origin of hereditary hemorrhagic telangiectasia type 1. BMC Medical Genetics, 18, 20.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!