Genemapper software v5

The seven published primer pairs, which were originally developed for the European bullhead species Cottus gobio [43 (link), 44 (link)], were used for microsatellite genotyping of our study species. Seven polymorphic nuclear microsatellite loci were chosen, including Cgo56, Cgo05, Cgo18, Cgo22 [43 (link)], Cott138, Cott207 and Cott112 [44 (link)]. The forward primers were labelled with fluorescent dye (FAM, NED, VIC and PET). PCR reactions were carried out as described for amplifying the mtDNA control region. PCR cycling conditions comprised an initial denaturation phase at 94 °C for 1 min, 35 cycles of 94 °C for 1 min, 57 °C–64 °C for 1 min, 72 °C for 1 min and a final extension step at 72 °C for 20 min. The PCR products were electrophoresed on an ABI 3730xl automated DNA sequencer (Applied Biosystems). Fragment sizes were determined to a ROX 500-bp size standard (ABI), as detected using GENEMAPPER software v5.0 (Applied Biosystems).

Twelve distinct polymorphic microsatellites markers were used to genotype the samples using a hemi-nested PCR protocol described by Anderson et al., (1999) [31 (link)] with slight modification. The markers included Poly α, TA40, ARA2, TA87, TAA81, TAI, TA42, TA60, 2490, PfG377, TA109 and PfPK2. Briefly, the primary reaction was carried out in a solution of 15 µL total containing 200 nM dNTP, 3 mM MgCl₂, 0.1 µM each of the unlabeled forward and reverse primer pairs, 0.05 U One Taq DNA Polymerase (New England Biolab, Ipswich, MA, USA) and about 30–50 ng of gDNA template. The secondary reaction contained the same reagents as the primary reaction with the exception of the primer pair that included 0.3 µM of a fluorescently labeled forward primer (6-FAM, HEX and Atto 565) and 0.1 µM of the unlabeled reverse primer used in the primary reaction (Table S1 in Supplementary Materials) with 3 µL of the primary reaction product in a final volume of 15 µL [31 (link)]. The fluorescently-labeled PCR products were separated using an Applied Biosystems 3130 series Genetic Analyzer and visualized using the GeneMapper software v 5.0 (Applied Biosystems, Foster City, CA, USA).

Polymorphic microsatellite markers (D17S666, D17S1853, D17S1606, D17S1161, D17S1604, D17S923, D17S808, and D17S794) flanking the recurrent RAD51C c.571 + 4A > G variant were genotyped in available relatives (Table S3), alleles were scored with GeneMapper Software v5.0 (Applied Biosystems), and haplotypes were constructed according to standard procedures (Abdelfatah et al., 2013). Specific alleles residing on the disease‐associated haplotype were compared with genotypes of a positive singleton case and population controls. Estimated variant age was calculated using standard procedures (Machado et al., 2007), with genetic distances inferred from the deCODE genetic map (Halldorsson et al., 2019) (Data S1).

Template DNA was amplified using H3F3A primers which were designed to cover the region encoding Lys27 and Gly34 in Histone H3.3 (forward: TGGCTCGTACAAAGCAGACT, reverse: ATGGATACATACAAGAGAGACT). HIST1H3B primers amplified the region encoding Lys27 and Gly34 in Histone H3.1 (forward: GTTTTGCCATGGCTCGTACT, reverse: AAGCGAAGATCGGTCTTGAA). PCR products were separated on 2% agarose gel then purified using Gene JET PCR Purification kit (ThermoFisher Scientific). Sanger sequencing was performed on the amplified DNA for detection of H3 (K27M) and (G34V/R) mutations, using the 3500 Series Genetic Analyzers (Applied Biosystems). Sequencing data was generated using Gene Mapper Software v5.0 (Applied Biosystems). Sequencing chromatograms were edited and visualized with Snap Gene software (from GSL Biotech; available at snapgene.com).

The samples were genotyped for 23 Y-STR loci using the PowerPlex^® Y23 System (Promega Corporation, Madison, WI, USA). Amplification was performed according to the manufacturer’s recommended protocol, and PCR products were separated and detected on an ABI3500 Genetic Analyzer (Applied Biosystems, Carlsbad, CA, USA). Genotyping was performed using the GeneMapper™ Software v5.0 (Applied Biosystems), and alleles were assigned based on the allelic ladder provided with the kit.

Seven polymorphic nuclear microsatellite loci were amplified with the published primers including SHORN18, SHORN26, SHORN27, SHORN30, SHORN31, SHORN34 and SHORN 41^{27 (link)}. Each of the forward primers was labelled with a fluorescent dye (FAM, HEX and TET). PCR reactions were conducted as described for the mtDNA cox3 gene. PCR cycling conditions were carried out as suggested in a previous study^{27 (link)}. The PCR products were electrophoresed on an ABI 3730xl automated DNA sequencer (Applied Biosystems). Fragment sizes were determined with the ROX 500 bp size standard (ABI) using GENEMAPPER software v5.0 (Applied Biosystems).

Microsatellite markers within the ±1 Mb flanking the gene being investigated were selected from the Genethon and Marshfield genetic map for linkage analysis. Markers and primer sequences are shown in Table S1. PCR reactions were performed (reaction conditions are available upon request). One μL PCR product was added to 10 μL of a mixture of GeneScan 500 LIZ Size Standards (Applied Biosystems, Inc.) and formamide, and analyzed on an ABI3730XL Genetic Analyzer (Applied Biosystems, Inc.). The results were analyzed using GeneMapper software V5.0 (Applied Biosystems, Inc.).