Calu 3

Human lung cancer cell lines (A549, Calu‐3, CAEP and SK‐MES‐1) and human bronchial epithelioid cells (HBE) were purchased from BeNa Culture Collection (Beijing, China) and cultured in Dulbecco's Modified Eagle Medium (DMEM) (Solarbio, Beijing, China) containing 10% fetal bovine serum (Zhejiang Tianhang Biotechnology, Huzhou, China) and 1% penicillin‐streptomycin solution (Procell, Wuhan, China).
The overexpression vectors of circCDR1as and SOX5 were generated with pcDNA3.1 vector (pcDNA) (YouBio, Changsha, China). The pcDNA vector was used as a negative control. The short interfering RNA (siRNA) for circCDR1as (si‐circCDR1as#1, 5′‐GCAAUAUCCAGGGUUUCCGAU‐3′; si‐circCDR1as#2, 5′‐UGUCUGCAAUAUCCAGGGUUU‐3′), siRNA negative control (si‐NC, 5′‐UUCUCCGAACGUGUCACGU‐3′), miR‐219a‐5p mimic (miR‐219a‐5p, 5′‐UGAUUGUCCAAACGCAAUUCU‐3′), mimic negative control (miR‐NC, 5′‐UUCUCCGAACGUGUCACGUTT‐3′), miR‐219a‐5p inhibitor (anti‐miR‐219a‐5p, 5′‐AGAAUUGCGUUUGGACAAUCA‐3′) and inhibitor negative control (anti‐NC, 5′‐CAGUACUUUUGUGUAGUACAA‐3′) were generated by Fulengen (Guangzhou, China). A549 and Calu‐3 cells were transfected with these conducted oligonucleotides or vectors using Lipofectamine 3000 (Thermo Fisher, Wilmington, DE, USA) for 24 hours.

Human bronchial epithelial cell line BEAS-2B (BNCC338205), and human LUAD cell
lines including A549 (BNCC337696), Calu-3 (BNCC338514), and NCI-H1299
(BNCC100268) were all provided by BeNa Culture Collection (Beijing, China).
Cells were all incubated in DMEM (Invitrogen) with 10% fetal bovine serum (FBS)
under standard conditions. Cells at the fourth passage were used for follow-up
experiments.

Human LUAD cell lines PC-9 (BNCC330767), A549 (BNCC337696), SPC-A-1 (BNCC100120), Calu-3 (BNCC359757), and human umbilical vein endothelial cells (HUVEC, BNCC337616) were supplied by BeNa Culture Collection (Beijing, China). Human lung cell line HLF-a was obtained from Procell (CL-0359, Wuhan, China). Dulbecco’s Modified Eagle Medium (DMEM, Gibco, USA) containing 10% fetal bovine serum (FBS) (Thermo Scientific HyClone, USA) was utilized for cell culture at 37°C with 5% CO₂.
The miR-218-5p mimics and negative control (NC micmic) were designed by GenePharma Biotech (Shanghai, China). In the present study, all transfections were transient. JetPRIME reagent (Polyplus-transfection) was added to cells. After transfected with RNA oligonucleotides for 48 h, cells were gathered for subsequent detection.

Human LUAD cell lines A-427 (BNCC341432), A549 (BNCC100215), Calu-3 (BNCC338514), PC-9 (BNCC340767) and human bronchial epithelial cell line BEAS −2B (BNCC338205) were all purchased from BeNa Culture Collection (BNCC, Beijing, China). All cell lines were cultured in Dulbecco’s Modified Eagle Medium (DMEM; sigma, USA) containing 10% fetal bovine serum (FBS; Hyclone; GE Healthcare Life Sciences, Logan, UT, USA), 100 μ/mL streptomycin (Gibco; Thermo Fisher Scientific, Inc.) and 100 μ/mL penicillin (Gibco; Thermo Fisher Scientific, Inc.), then nurtured in 5% CO₂ at 37 °C. The cells used in this study were all at 2–4 passages after recovery.