To evaluate the efficiency of siRNA knockdown in HeLa cells, we performed real-time PCR analyses. HeLa cells were transfected with the indicated siRNA or scrRNA control. cDNA was obtained using a Cells-to-cDNA kit (Ambion). Genomic DNA was removed using a DNA removal kit (Ambion). cDNA was obtained using the oligo dT primer. Real-time PCR was performed using a Fast SYBR Green master mix (Applied Biosystems). Primer sequences for the expression analysis were as follows: KCNA1, TTCTTCGACCGCAACCGGCC and AGCTATCTCGGTGCCCAGGGT; RPL14, AGGTTGGCCGGGTGGCCTAT and AGGCGCTGCTTTCTGGCCTG; SBP2, GCAGGCAGAGCTGTCAGGGC and TGGGCTCTCCCACCAGCTCC. Special 18S rRNA modified primers (Ambion) were used as an internal control for data normalization. We also compared the consequence of downregulation with the individual and pooled DNAJC17 siRNAs, since knockdown of this gene showed the strongest effect on ATP7A levels. These studies revealed that only one individual siRNA (#2) decreased the ATP7A levels similarly to the pool, whereas other individual siRNA (and a combination of three out of four, #1, #3 and #4) had no significant effect on ATP7A levels despite a significant decrease in the mRNA levels for DNAJC17 (confirmed by real-time PCR). Thus, the effect of DNAJC17 knockdown on ATP7A may be indirect or confounded by other unknown factors.
Cells to cdna kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Cells-to-cDNA kit is a laboratory product designed for the rapid and efficient isolation of total cellular RNA from small cell samples. The kit provides a simple, streamlined workflow to convert cellular RNA into complementary DNA (cDNA) suitable for downstream applications, such as gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Special 18s rrna modified primers, by Thermo Fisher Scientific (2 mentions)
Dna removal kit, by Thermo Fisher Scientific (2 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Cytofix cytoperm, by BD (2 mentions)
Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Cell lysis buffer, by Thermo Fisher Scientific (1 mentions)
Nanovue plus, by GE Healthcare (1 mentions)
Sybr green, by Qiagen (1 mentions)
9 protocols using cells to cdna kit
1
Evaluating siRNA Knockdown Efficiency in HeLa Cells
2
Isolation and Characterization of Tumor Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tumors were resected, minced, and digested in 400U/ml type II collagenase at 37°C while shaking. Single cell suspension following filtering through 75 μm mesh were fixed in BD Cytofix/Cytoperm (BD Biosciences) and stained in 2% FBS containing PBS with DMEM with anti mouse αSMA primary antibody and TRITC conjugated secondary antibody. All FACS analyses were performed at the Joslin Diabetes Center Flow Cytometry Core, Boston, MA. FACS purified cells were spun down at 5,000 rpm for 10 minutes at 25°C and cell pellet processed for quantitative PCR analysis using Cells-to-cDNA kit (Ambion) according to the manufacturer's direction. CCC and PCC were also FACS purified and cytospin (onto glass slides at 800rpm for 5 min) stained following a 10 min acetone fixation step at 4°C.
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was prepared using a cells-to-cDNA kit as per the manufacturer's instructions (Ambion). Samples without reverse transcriptase and no-template controls served as negative controls. Real-time qPCR reactions were performed using a ViiA7 Real Time PCR System (Life Technologies). All samples were run in duplicate with a coefficient of variation between duplicates of <1.0 cycle. Analysis was carried out using the delta-delta cT method.54 (link)
4
Pck1 cDNA Cloning and Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cDNA was obtained using the Cells to cDNA kit (Ambion, USA). Pck1 cDNA was amplified with AccuPrimeTMTaq DNA Polymerase High Fidelity and 12.5% DMSO, followed by nested PCR including 5% DMSO. NdeI-XhoI digestion products were cloned into pET15b (provided with a PreScission Protease cleavage site, courtesy of Dr. Ramón Hurtado Guerrero, BIFI, Spain) and EcoRI-XhoI fragments were cloned into pCMV-Myc. DNA was isolated from E. coli DH5α colonies and sequenced.
5
Isolation and Characterization of Tumor Cells
6
IL-17A Effects on Chondrocytes and Synovial Fibroblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chondrocytes and synovial fibroblasts were cultured and plated out in 96-well plates as described earlier. Secukinumab with 10ng/ml IL-17A or vehicle control was added to the cells. After 24 hours, cells were washed with PBS before being harvested in cells-to-cDNA Cell Lysis Buffer (Ambion Inc, Foster City, CA, USA), and transferred to a PCR plate for cells-to-cDNA synthesis. cDNA was prepared using a cells-to-cDNA kit following the manufacturer’s instructions (Ambion).
7
Oocyte Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The oocytes obtained at the first OPU were used for gene expression analysis. A pool of four oocytes (viables) from each female was quickly frozen in liquid nitrogen after going through the denudation process (pipetting). For total RNA extraction and cDNA synthesis, the Cells-to-cDNA kit (Ambion–Austin, USA) was used according to the manufacturer’s recommendations. Quantitation of cDNA concentration was performed using 1 μL of sample in a NanoVue Plus spectrophotometer (GE Healthcare). Finally, the samples were diluted to 10 ng/μL concentration and the material was stored at −20°C for real-time PCR analysis.
8
Evaluating siRNA Knockdown Efficiency in HeLa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate the efficiency of siRNA knockdown in HeLa cells, we performed real-time PCR analyses. HeLa cells were transfected with the indicated siRNA or scrRNA control. cDNA was obtained using a Cells-to-cDNA kit (Ambion). Genomic DNA was removed using a DNA removal kit (Ambion). cDNA was obtained using the oligo dT primer. Real-time PCR was performed using a Fast SYBR Green master mix (Applied Biosystems). Primer sequences for the expression analysis were as follows: KCNA1, TTCTTCGACCGCAACCGGCC and AGCTATCTCGGTGCCCAGGGT; RPL14, AGGTTGGCCGGGTGGCCTAT and AGGCGCTGCTTTCTGGCCTG; SBP2, GCAGGCAGAGCTGTCAGGGC and TGGGCTCTCCCACCAGCTCC. Special 18S rRNA modified primers (Ambion) were used as an internal control for data normalization. We also compared the consequence of downregulation with the individual and pooled DNAJC17 siRNAs, since knockdown of this gene showed the strongest effect on ATP7A levels. These studies revealed that only one individual siRNA (#2) decreased the ATP7A levels similarly to the pool, whereas other individual siRNA (and a combination of three out of four, #1, #3 and #4) had no significant effect on ATP7A levels despite a significant decrease in the mRNA levels for DNAJC17 (confirmed by real-time PCR). Thus, the effect of DNAJC17 knockdown on ATP7A may be indirect or confounded by other unknown factors.
9
Circadian rhythm gene expression in chondrocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chondrocytes isolated from undamaged and damaged cartilage from each patient (n=7 patients) were plated in 96-well plates. Following 24h serum starvation, cDNA was prepared from a subset of chondrocytes from each patient (t=0h) using a cellsto-cDNA kit as per the manufacturer's instructions (Ambion, Austin, TX). Remaining chondrocytes were media changed to basal medium. At four-hourly intervals over a 24h period, subsets of the cultured chondrocytes (n=7 patients) were harvested for cDNA synthesis. mRNA levels of BMAL1, CLOCK, PER1, PER2, CRY1 and CRY2 were measured by real time RT-qPCR (SYBR green) and commercially-available primers (Qiagen, UK).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!