The largest database of trusted experimental protocols

Kapa taq kit

Manufactured by Roche
Sourced in United Kingdom, United States

The KAPA taq kit is a DNA polymerase-based reagent kit designed for PCR amplification. The kit contains a thermostable DNA polymerase enzyme, reaction buffers, and other necessary components to perform polymerase chain reaction (PCR) experiments.

Automatically generated - may contain errors

2 protocols using kapa taq kit

1

In Vitro mRNA Synthesis and Transfection in hESCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
In vitro mRNA synthesis and transfections were performed according to previous protocols.46 (link) In brief, T7 promoter and polyA tail were added by polymerase chain reaction (PCR) using KAPA taq kit (Kapabiosystems, London, UK). RNA was transcribed from the template using MEGAscript T7 kit (Ambion, Carlsbad, CA, USA), with ARCA cap analog (New England Biolabs, Ipswich, MA, USA); ATP; GTP; 5-Methyl-CTP (TriLink, San Diego, CA, USA); and pseudo-UTP (TriLink). Synthesized RNAs were purified with the MEGAclear kit (Ambion). RNA transfections were performed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. To increase the viability of transfected cells, B18R interferon inhibitor (eBioscience, San Diego, CA, USA) was supplemented to the culture medium. One day before transfection, 30,000 hESCs were seeded on a culture plate, and 1 µg/well of each synthetic modified mRNA was induced. The hESCs were subjected to four consecutive transfections with TF-encoding RNAs, or GFP or mCherry mRNAs as controls with Lipofectamine 2000 (Life Technologies) in StemFit AK-03 with B18R (eBioscience) for the first two days of differentiation. After two consecutive days of transfection, the culture medium was changed to DKSFM with 100 μg/mL CT and 10 ng/mL EGF.
+ Open protocol
+ Expand
2

Synthesis of dsRNA for GSTe Gene Silencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Double-stranded RNAs specific to GSTe genes of interest were synthesized for use in RNAi gene-silencing experiments. Each GSTe oligonucleotide primer was designed using specific cDNA of the corresponding genes downloaded from the Vector Base (https://vectorbase.org/vectorbase/app, accessed on 8 December 2016). The T7 RNA polymerase promoter sequence, TAATACGACTCACTATAGGGAGA, was added to the 5′ end of each primer (Supplementary Table S2.2). Specific GST2, 3, 4, 5, 6, 7 and GSTe8 fragments were amplified by PCR from plasmid clones using KAPA Taq Kit (Kapa Biosystems, Wilmington, MA USA). Double-stranded RNA (dsRNA) was synthesized using in vitro transcription MEGAscript®® T7 Kit (Ambion Inc., Austin, TX, USA) and purified using MEGAclear columns (Ambion). The purified products were concentrated by ethanol precipitation and the dsRNA was resuspended in nuclease-free water and stored at −20 °C. The successful construction of dsRNA was confirmed by running 3 μL of dsRNA-diluted products in 1.5% agarose gel in a Tris-acetate-EDTA (TAE) buffer.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!