Ab109219

qRT‐PCR, western blot, and co‐IP assays were conducted according to the earlier description.²⁸ The primers used for qRT‐PCR were: USP10: forward: 5‐AATAAAGGGAACTGGTGC‐3, reverse: 5‐CTATCATGGGTGTTGACGT‐3; YAP1: forward: 5‐GCAACTCCAACCAGCAGCAACA‐3, reverse: 5‐CGCAGCCTCTCCTTCTCCATCTG‐3; and GAPDH: forward: 5‐AGCCTCAAGATCATCAGCAATG‐3, reverse: 5‐CCATCACGCCACAGTTTCC‐3. The antibodies used for western blotting were: USP10 (Abcam, ab109219, 1:1500 dilution), YAP1 (Abcam, ab52771, 1:1000 dilution), vimentin (Abcam, ab92547, 1:1500 dilution), E‐cadherin (Abcam, ab40772, 1:1500 dilution), N‐cadherin (Abcam, ab18203, 1:1500 dilution), and GAPDH (Abcam, ab9485, 1:5000 dilution).

The following monoclonal antibodies were used: USP10 (ab109219, Abcam), RUNX1 (ab240639, Abcam), FLAG-tag (cat#14793, Cell Signaling Technology), His-tag (cat#12698, Cell Signaling Technology), HA-tag (cat#3724, Cell Signaling Technology), YKL-40 (#AF2599, Novus Biologicals), Olig2 (cat# sc-293163, Santa Cruz), PDGFRα (cat# 3174, Cell Signaling Technology), MET (cat# sc-8057, Santa Cruz), COL5A1 (cat# 86903, Cell Signaling Technology) and β-actin (ab8227, Abcam). Spautin-1 (cat# 17769), an inhibitor of USP10, was supplied by Cayman. Cycloheximide (CHX, cat# C7698), a specific inhibitor for protein translation, was purchased from Sigma. MG132 (cat# S2619), the proteasome inhibitor, was supplied by Selleckchem.

Western blot was carried out as described previously [16 (link)]. The total proteins of AGS, MKN-45 and 293T cells were extracted by using RIPA lysis buffer (KeyGEN BioTECH, China). Afterwards, the total proteins were treated with 10% SDS/PAGE Resolving Gel Master Mix (P0670-250ml, Beyotime, China) for separation, followed by transfer onto polyvinylidene fluoride (PVDF) membranes (T2234, Thermo Fisher, USA). Then, 5% skim milk was adopted to block the membranes, which were then subjected to incubation with primary antibodies overnight at 4°C. After the washes, the membranes were incubated with secondary antibodies for 1 h at room temperature. The results were then visualized and recorded. β-Actin was used as an internal reference. Bio-repeats were implemented in triplicate. The primary antibodies used in this assay include Anti-β-actin, Anti-MMP2 (ab181286, Abcam, UK), Anti-MMP9 (ab228402, Abcam), Anti-USP10 (ab109219, Abcam) and Anti-RFC2 (ab174271, Abcam).