Block it rna designer

shRNA was designed with BLOCK-iT™ RNA Designer (Invitrogen). The shRNA sequences (21 bp sense) are as follows. Scramble: CAACAAGATGAAGAGCACCAA; sh-1#: GCGTAGTCACATCTTTGTACT; and sh-2#: GCAACCGCTCCATCAAGAAAG. shRNA was cloned into the pLKO.1 plasmid following the protocol from Addgene (Moffat et al., 2006 (link)). shRNA plasmid, psPAX2, and pMD2.G (4:3:1) were cotransfected into HEK-293T cells using Lipofectamine 2000 (Thermo Fisher Scientific, 11668019). After 48 h, the supernatant was collected and filtered through a 0.45-μm membrane (Millipore) to obtain knockdown virus particles. Human TMEM201, LaminA, and SUN2 cDNAs were cloned into the pLVX-IRES plasmid with a Flag or Myc tag. The overexpression plasmids psPAX2 and VSVG (5:3:2) were cotransfected into HEK-293T cells, and overexpression virus particles were collected. HUVECs or EA.hy926 cells were infected with the appropriate amount of knockdown or overexpression virus particles. After 48 h, the infected ECs were subjected to various tests.

PC‐12 cells are transfected with siRNA for CLN3 knock‐down (BLOCK‐iT RNA^™ Designer, Invitrogen)/scrambled control (HiPerfect Transfection, Qiagen). CLN3 knockdown is validated by quantitative real‐time PCR (qRT‐PCR) at 24/48/72 h, and normalized to β‐actin. Expression levels are calculated using the ΔΔC_T method. Primer sequences (Tm = 60^○C) include: CLN3 forward, 5′AGACCCTCATCCCTCCCGT3′; reverse, 5′GAATCCGAAAAGCGCCGCC3′; β‐Actin forward, 5′ACACTGTGCCCATCTACGAG3′; reverse, 5′ATTTCCCTCTCAGCTGTGGT3′.