Genomic dsRNA was purified from BYD1-infected cells as previously described [21] (link). The viral M2 gene was amplified using primers mu1f (5′-TCCAAGCTTATGGGGAACGCTTCCTCTATC-3′ ) and mulr (5′-TATGGGCCCTCAACGTGTGTACCCACGT-3′ ), introducing HindIII and ApaI sites, respectively, a SuperScript II Reverse Transcriptase kit (Life Technologies), and a PrimeSTAR HS DNA Polymerase kit (Takara). The pEGFP-C3 plasmid (Clontech) and the amplicon were then doubly digested with HindIII and ApaI, and the fragments were purified with a QIAEX II Gel Extraction Kit (Qiagen) and ligated using T4 DNA ligase (NE Biolabs), according to manufacturer's specifications. The ligation mixture was then transformed into chemically competent Escherichia coli DH5α cells. A kanamycin-resistant clone was isolated and the pEGFP-C–μ1 plasmid was purified and sequenced, confirming the plasmid to be as predicted. The vector pEGFP-C–σ1 was constructed in a similar manner using primers sigma1f (5′-TTCAAGCTTATGTCTGAGCTGATTCAGC-3′ ) and sigma1r (5′-AAAGGGCCCTCAGCCTAAGCATGGATACAT-3′ ). The plasmids were purified with an endotoxin-free plasmid purification kit (Qiagen). 293 T cells were transfected with pEGFP-C3, pEGFP-C–μ1, or pEGFP-C–σ1 using Lipofectamine 2000 (Life Technologies), according to the manufacturer's instructions.
Endotoxin free plasmid purification kit
Manufactured by Qiagen
Sourced in United States
The Endotoxin-free plasmid purification kit is a laboratory tool designed to isolate and purify plasmid DNA from bacterial cultures. It is intended for use in molecular biology and genetic engineering applications.
Automatically generated - may contain errors
Lab products found in correlation
Qiaex 2 gel extraction kit, by Qiagen (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Superscript 2 reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
Pegfp c3 plasmid, by Takara Bio (1 mentions)
Primestar hs dna polymerase kit, by Takara Bio (1 mentions)
Midiprep kit, by Promega (1 mentions)
Psicheck2 vector, by Thermo Fisher Scientific (1 mentions)
Takara la taq, by Takara Bio (1 mentions)
Kod plus mutagenesis kit, by Agilent Technologies (1 mentions)
Endotoxin free giga prep kit, by Qiagen (1 mentions)
6 protocols using endotoxin free plasmid purification kit
1
Gene Cloning and Expression of Viral Proteins
2
Mitochondrial Targeted ATP Sensor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
iATPSnFR2.HaloTag variants were subcloned by restriction digest into an AAV vector with a CAG promoter via BglII/PstI digest from the bacterial expression vector. The pAAV.CAG vector includes an extra serine after the initial methionine and lacks a polyhistidine tag. To target the sensor to the mitochondrial matrix, four repeats of COX8(mito) leader sequence (SVLTPLLLRGLTGSARRLPVPRAK) separated by spacer (IHSLPPEGPW) were introduced at the N terminus of iAPTSnFR2(A95A/A119L). HaloTag was incorporated at the N-terminal of iATPSnFR2.A95A.A119L separated by a linker (LQSTGSGNAVGQDTQER). The plasmid was transformed into stbl3 competent E. coli, and DNA was harvested from 200 mL growth media using an endotoxin-free plasmid purification kit (Qiagen).
3
CYP2D6/FTCD DNA Construct Generation
4
Expression Plasmids for Virus-Free Protein Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Suitable expression plasmids were chosen for the respective expression system. The transient transfection in High Five cells was facilitated with the pOpiE2 plasmid, which is in our hands the best expression vector for virus-free protein expression [37 (link)]. Important to note is that it does not only contain the immediate early promoter OpiE2 but also the highly functional IE1 terminator, as well as enhancing sequences [30 (link)]. The Multi-Host vector pFlpBtM-II was used for expression in HEK293-6E cells and for generating the EmBacY baculoviral genome for BEVS [38 (link)]. The target genes were cloned into the respective multi-cloning sites using either restriction digestion according to standard protocols or by sequence and ligation independent cloning (SLIC) [39 (link)]. The plasmids used are named pOpiE2-eGFP-HA; pFlpBtM-II-H1, pOpiE2-H1 and pcDNA3 (stuffer DNA vector). Every expression plasmid was prepared by the NucleoBond PC, Xtra (Macherey-Nagel) or the PureYield (Promega) Midiprep Kit according to the description of the manufacturer. DNA purification kits from other manufacturer like the endotoxin free plasmid purification kit of Qiagen equally well-suited to generate high quality DNA samples for TGE.
5
Cloning and Mutagenesis of Mouse MCL-1 3'UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3′UTR of mouse MCL-1 mRNA (NM_000286) was retrieved from the GenBank Database and amplified using synthetic primers: MCL-1 forward (5′GCTAGCCGCTACTAGGCTCCCC3′) and MCL-1 reverse (5′CGGGTAGTATATACGCGTCGTTAC3′). The product was cloned into a psiCHECK2 vector (Invitrogen, Carlsbad, CA, USA). Recombinant vector was then amplified in DH5α Escherichia coli and purified using an endotoxin-free plasmid purification kit (QIAGEN, Valencia, CA), according to the manufacturer's instructions. Each segment was amplified by PCR with Takara LA Taq or Primestar (Takara Bio, Inc., Otsu, Japan) and cloned into the vector. Mutation of the miR-29b binding sites in the MCL-1 3′UTR sequence was performed using a KOD-Plus-Mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA), according to the manufacturer's protocol. All constructs were confirmed by restriction enzyme digest and sequencing (Sangon Biotech, Shanghai, China).
6
Lipid-based Delivery of Genetic Cargo
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lipids 1,2-distearoyl-sn-glycero-3-phosphorylcholine (DSPC) and 1,2-distearoyl-sn-glycero- . pDNA encoding TdTomato 15 was purchased from Addgene (Cambridge, MA) and prepared using a Qiagen Endotoxin-free Giga prep kit (Hilden, Germany). Minicircle DNA (mcDNA) was generated by transforming the mcDNA producer plasmids into E. coli ZYCY10P3S2T and purification of resulting mcDNA vectors using the Qiagen Endotoxin-free plasmid purification kit as previously described. 16 siRNA against firefly luciferase 17 was purchased from IDT (Coralville, IA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!