Allprep dna rna mini or micro kit

DNA was isolated using the AllPrep DNA/RNA mini or micro Kit or QIAamp DNA Micro Kit (Qiagen, 56304). For panel sequencing, 250 ng of genomic DNA from patient and xenograft samples was subjected to the Nextera DNA Flex Kit with the usage of unique dual indices. The enrichment was performed using the IDT Hybridization Capture protocol and a corresponding custom myeloid panel (IDT, Integrated DNA Technologies, Coralville, IA, USA) including the following genes: ASXL1, ASXL2, ATRX, BCOR, BCORL1, BRAF, BRCC3, CALR, CBL, CDH23, CDKN2A, CEBPA, CREBBP, CSF3R, CSNK1A1, CTCF, CUX1, DDX41, DDX54, DHX29, DNMT3A, EP300, ETNK1, ETV6, EZH2, FLT3, GATA1, GATA2, GNAS, GNB1, IDH1, IDH2, JAK2, KDM5A, KDM6A, KIT, KMT2D, KRAS, MPL, MYC, NF1, NPM1, NRAS, PHF6, PIGA, PPM1D, PRPF8, PTPN11, RAD21, RUNX1, SETBP1, SF1, SF3A1, SF3B1, SH2B3, SMC1A, SMC3, SRSF2, STAG2, SUZ12, TET2, TP53, U2AF1, U2AF2, WT1, ZBTB7A, ZRSR2. The final library pools were sequenced on a S4 Nova Seq Flow Cell (Illumina) with 150 bp paired end reads. Mean sequencing depth was 1532.9-fold. Bioinformatical processing consisted of quality trimming using Seqtk (version 1.2) and was followed by a comprehensive quality control by using the FastQC package (version 0.11.5). Known false positive variants or single nucleotide polymorphisms were filtered out.

RNA was isolated using the AllPrep DNA/RNA mini or micro Kit (Qiagen, 80204 or 80284 respectively). cDNA synthesis was performed using the QuantiTect Reverse Transcription kit (Qiagen, 205311). RT-qPCR for the analysis of LOX and LOXL1-4 gene expression was performed using a LightCycler 480 Instrument II (Roche Life Science) and LightCycler 480 SYBR Green I Master mix (Roche Life Science, 4887352001). Gene expression data were normalized to the expression of β-glucuronidase (GUS). Relative gene expression were calculated using the 2^-ΔΔCt method^{35 (link)}. Primer sequences are summarized as below:
GUS:
Forward primer (5’− 3’), gaaaatatgtggttggagagctc
Reverse primer (5’− 3’), ccgagtgaagatccccttttta
LOX:
Forward primer (5’− 3’), ggatatagcggtacatatgatccttag
Reverse primer (5’− 3’), aagctctgtctgtattgtctactggt
LOXL1:
Forward primer (5’− 3’), cgctatgcatgcacctctc
Reverse primer (5’− 3’), gatgtccgcattgtaggtgtc
LOXL2:
Forward primer (5’− 3’), ggagaggacatacaataccaaagtgt
Reverse primer (5’− 3’), ccatggagaatggccagtag
LOXL3:
Forward primer (5’− 3’), acaggctggacccacagt
Reverse primer (5’− 3’), ctgcagctcaagttgtccag
LOXL4:
Forward primer (5’− 3’), gctgcacaactgccacac
Reverse primer (5’− 3’), ggttgttcctgagacgctgt