Tripure isolation reagent

Total RNA was extracted from cells using TRIpure isolation reagent (BioTeke, Beijing, China). qRT-PCR analysis was performed as previously described [28 (link)]. Briefly, first-strand cDNA was synthesized from total RNA using cDNA synthesis kit (BioTeke). Then, real-time PCR was performed using the SYBR Green kit (Solarbio) and detected by Exicycler TM 96 (Bioneer, Daejeon, Korea). GAPDH was acted as internal control. The primer sequences were synthesized by GenScript Biotechnology (Nanjing, China) and listed as the following: MAPK p38 forward, TAAAGCCCAGCAACCTCG, reverse, CAGCCCACGGACCAAATA; PPARγ forward, TACCACGGTTGATTTCTC, reverse, AATAATAAGGCGGGGACG; CTGF forward, GTCTTCGGTGGGTCCGTGTA, reverse, GCGGTCCTTGGGCTCATCAC; CyclinD1 forward, GAGGAGCAGAAGTGCGAAGA, reverse, GGCGGATAGAGTTGTCAGTGTAG; caspase-3 forward, GACGACAGGGTGCTACGAT, reverse, TTTCCTTACGCTCTGACTGA; β-actin forward, GGAGATTACTGCCCTGGCTCCTAGC, reverse, GGCGGACTCATCGTACTCCTGCTT. The reaction was conducted with an initial denaturing step at 94°C for 5 min, followed by 40 cycles of 94°C for 10 s, 60°C for 20 s, and 72°C for 30 s. The relative expression was analyzed by the 2^-ΔΔCt method.

Total RNAs were isolated with TriPure isolation reagent (Bioteke, Beijing, China), and processed into cDNAs via Super M-MLV reverse transcriptase (Bioteke). PCR products were analyzed in agarose gel (1.5%) electrophoresis. The relative gene expression levels were determined by real-time RT-PCR. In short, cDNA templates were mixed with primers (Genscript, Nanjing, China), Sybr Green (Sigma-Aldrich, St. Louis, MO, USA) and 2 × Power Taq PCR MasterMix (Bioteke), and analyzed on an Exicycler™ 96 PCR instrument. Housekeeping gene GAPDH was used as a reference. Primer information was as following: CNR2–F 5′–agccctcatacctgttcattgg–3′; CNR2–R 5′–gtgaaggtcatagtcacgctg–3′; osteopontin–F, 5′–gaagtttcgcagacctgacat–3′, osteopontin–R 5′–gtatgcaccattcaactcctcg–3; osteocalcin–F, 5′ –cactcctcgccctattggc–3′, osteocalcin–R, 5′–ccctcctgcttggacacaaag–3′. Data from real-time PCR results were calculated via the 2^−ΔΔCt method.

The relative expression levels of JNK1, JNK2, c-jun, Bax, and Bcl-2 were determined by RT-PCR assay. Total RNA was extracted with TRIpure isolation reagent (RP1001; BioTeke, Beijing, China). The concentrations of RNA in each sample were determined using an ultraviolet spectrophotometer NANO 2000. cDNA synthesis was performed using Super M-MLV reverse transcriptase (PR6502; BioTeke, Beijing, China). Differential RT-PCR was conducted on ExicyclerTM 96 (BIONEER, Korea). An endogenous reference gene β-actin was used as an internal reference. The relative levels of target genes were measured using the 2^−ΔΔCt method. Each experiment was performed in triplicate. Primer sequences are summarized in Table 1.