At post-natal day 42, mice were anesthetized in an airtight container using 5% isoflurane and placed in a stereotaxic apparatus. Anesthesia was maintained using 2% isoflurane during surgery. The intrahippocampal injection of KA was performed as described before (Bielefeld et al., 2017 (link)). In short, a small hole was drilled in the skull above both the hippocampi at the following coordinates: anteroposterior (AP) -2.0, mediolateral (ML) +1.5/-1.5. A pulled microcapillary was inserted and positioned at dorsoventral (DV) -2.0 and 50 nL of Saline (SAL) or KA (0.74, 2.22, or 20 mM) was infused into the DG using a microinjector (Nanoject II, Drummond Scientific). A second cohort of animals underwent the same stereotaxic procedure. Using the same bregma coordinates and a pulled microcapillary, 1.0 μL of an equimolar (50 μM) mix of microRNA-124 and -137 AMOs (Mirvana miRNA inhibitors, miRNA-124: CGUGUUCACAGCGGACCUUGAU; miRNA-137: ACGGGUAUUCUUGGGUGGAUAAU) was infused (50 μM, 0.2 μL/minute) using a microinjector (Nanoject II, Drummond Scientific). When necessary, mice were given intraperitoneal physiological saline injections to prevent dehydration after seizure onset.
Nanoject 2
Manufactured by Drummond
Sourced in United States, Panama, Germany
The Nanoject II is a micropipette injector designed for precise and accurate microinjection of samples into cells or embryos. It features a microprocessor-controlled system that allows for the delivery of nanoliter volumes with high repeatability. The device is capable of handling a wide range of sample types and volumes, making it a versatile tool for various applications in the field of cell biology and embryology.
Automatically generated - may contain errors
Lab products found in correlation
Stereotaxic frame, by Kopf Instruments (6 mentions)
T7 ribomax express rnai system, by Promega (6 mentions)
Stereotax, by Kopf Instruments (4 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
Rneasy kit, by Qiagen (3 mentions)
Msgvn2250, by Merck Group (3 mentions)
Ecm 830, by Harvard Apparatus (3 mentions)
Nanoject 3, by Drummond (3 mentions)
Heparin affinity columns, by Merck Group (3 mentions)
Beveled glass micropipette, by Drummond (3 mentions)
Phosphate buffered saline (pbs), by Merck Group (3 mentions)
Columbia agar base, by Thermo Fisher Scientific (3 mentions)
Collagenase type 2, by Thermo Fisher Scientific (3 mentions)
Collagenase type 2, by Merck Group (3 mentions)
Ctb 555 recombinant retrograde tracer, by Thermo Fisher Scientific (2 mentions)
Vevo 770 ultrasound backscatter microscopy, by Fujifilm (2 mentions)
Aquasonic 100 ultrasound gel, by Parker Laboratories (2 mentions)
Amphotericin b, by Thermo Fisher Scientific (2 mentions)
Megascript t7 kit, by Thermo Fisher Scientific (2 mentions)
Small animal stereotaxic frame, by Stoelting (2 mentions)
397 protocols using nanoject 2
1
Intrahippocampal Kainic Acid Injection and microRNA Inhibition in Mice
2
Targeted miRNA Inhibition in Mosquitoes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antagomirs (anti-miR-276-5p and a scrambled version of the same antagomir that has no target in A. gambiae genome) were designed using the RNA module for custom single-stranded RNA synthesis (Dharmacon) as RNA antisense oligos with 2′-O-methylated bases, a phosphorothioate backbone at the first two and last four nucleotides and a 3′cholesterol (Supplementary Table 2 ). For miRNA inhibition, mosquitoes were anesthetized with CO2 and microinjected with 207 nl of 200 µM antagomir (41 pmol/female) at 12–18 h post eclosion using the Drummond NanoJect II (Drummond Scientific). Mosquitoes were left for four days to recover before a blood feeding or P. falciparum infection.
3
Functional Expression of DTX18 in Oocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Defolliculated X. laevis oocytes, stage V–VI, were purchased from Ecocyte Bioscience (Dortmund, Germany). Oocytes were injected with 50.6 nl of DTX18 cRNA (or nuclease-free water as a mock control) using a Drummond NANOJECT II (Drummond Scientific Company, Broomall, PA, USA). The oocytes were then incubated for three days at 16 °C in kulori buffer (90 mM NaCl, 1 mM KCl, 1 mM MgCl2, 1 mM CaCl2, and 10 mM HEPES at a pH of 7.4) supplemented with 100 µg mL−1 amikacin.
4
Xenopus Oocyte Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Xenopus oocytes were purchased as defolliculated Xenopus oocytes (stages V–VI) from Ecocyte Biosciences (Germany). Injection of 50 nl complementary RNA (500 ng μl−1) into Xenopus oocytes was done using a Drummond NANOJECT II (Drummond Scientific). Oocytes were incubated for 3 days at 17 °C in Kulori (90 mM NaCl, 1 mM KCl, 1 mM MgCl2, 10 mM MES) pH 7.5 before assaying.
5
RNAi-mediated Knockdown in Tribolium Larvae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
There were three groups in this study: T. castaneum larvae injected with water/dye (Mock); larvae injected with ADC-dsRNA construct (ADC) mixed with dye; and a noninjected (Control) group. Immediately before injection, treatments (water or dsRNA) were mixed with blue dye (FD&C Blue 1, Kroger Food Colors, Cincinnati, OH; diluted 1:20) to aid in visualization of the injected liquid. Actively feeding, third instar larvae were briefly placed on ice and transferred to double-sided tape on a microscope slide placed on a small tissue culture flask ice block (Posnien et al. 2009 ). Briefly, a Drummond Nanoject II (Drummond Scientific Co., Broomall, PA) with a “bee-stinger” needle was set at 69 nl, and dsRNA was diluted to provide 200 ng of dsRNA per larva (Perkin et al. 2017 (link)) and loaded into the needle. Needles were made with 3.5 Drummond glass capillary tubes (3-000-203-G) and a micropipette puller (Sutter Instrument Co. Model P-97, Novato, CA). After injection, each group was allowed to recover for 2 h at room temperature, and then were covered with diet (95% wheat flour, 5% Brewer’s yeast) and kept at 28 °C, 75% relative humidity, 0:24 (L:D) h. All injections in a single replicate were done on the same day, with a total of three independent replicates per treatment.
6
Spinal Cord and Brain Cytokine Injections
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stereotaxic injections were performed by Washington University's animal surgery core using a David Koft stereotaxic frame. Adult male and female Cxcr7GFP/+ animals were shaved and anesthetized with 2% isoflurane prior to surgery. The surgical site was cleaned with 75% ethanol, followed by 1% betadine. A 1.0 cm sagittal incision was made at the level of L2/L3 vertebrae for spinal cord injections or at the brain stem. A glass needle was inserted at the incision site using the Drummond Nanoject2. Stereotaxic injections were performed at a depth of 0.5 mm, just lateral to midline. A volume of 0.25 μl recombinant mouse TNFα (25 ng, R&D Systems), recombinant mouse IFNγ (25 ng, Biolegend), or vehicle (PBS) was injected. After microinjection, the dorsal muscle was sutured with 4–0 silk. The incision skin was pulled together using forceps and sutured using 4.0 nylon. The mice were kept on a heating pad until awake. Animals were sacrificed 72 hr postinjection.
7
Viral Vectors for Neural Circuit Tracing
8
Transsynaptic Tracing with Engineered AAVs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AAV vectors containing CAG‐FLEx‐TC66T (2 × 1012 genomic copies per ml) and CAG‐FLEx‐oG (1 × 1012 genomic copies per ml) were produced by the ELSC vector core facility. For transsynaptic tracing, 0.1 µl of the mixture of AAV2‐CAG‐FLEx‐TC66T and AAV2‐CAG‐FLEx‐oG was stereotaxically injected into the left auditory cortex (coordinates relative to Bregma: anterior 2.5 mm, lateral 4.2 mm, depth 1.85 mm at 20 degrees tilt from a vertical position) by using Nanoject 2 (Drummond Scientific). EnvA‐Pseudotyped RabiesΔG (5 × 1010 infectious particles per ml) was produced following the established protocol (Osakada & Callaway, 2013 (link); Wickersham et al., 2007 (link)).
9
Stereotactic Viral Injections in Mice
10
Optogenetic Self-Stimulation in VTA-NAc Circuit
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice > 6 weeks old were anesthetized with isoflurane (4% for induction; 1-2% maintenance) and placed in a stereotaxic frame (Kopf Instruments). AAV1-FLEX-ChR2-EYFP (8 x 10 12 vg/mL) was combined with either AAV1-FLEX-SaCas9-U6-sgVglut2 (1.5
x 10 12 vg/mL), AAV1-FLEX-SaCas9-U6-sgTh (1.8 x 10 12 vg/mL), or AAV1-FLEX-SaCas9-U6-sgRosa26 (1.5 x 10 12 vg/mL) such that ChR2-YFP constituted 1/7 th of the total volume and the respective SaCas9 constituted 6/7 th of the total volume. 400nL of this mixture was injected into the VTA of VGLUT2cre mice (Distance from Bregma in mm: -3.4 AP; +0.35 ML; -4.4 DV) at 100nl/min using a glass pipette attached to a microinjector (Nanoject 2, Drummond Scientific). Following viral infusion, the injector tip was kept in place for 10 min before slowly retracting. For optogenetic self-stimulation experiments, optic fibers (200µm core; Newdoon) were subsequently placed bilaterally above NAc medial shell at a 10° medio-lateral angle (+1.4 AP; ±1.13 ML; -3.81 DV).
Optic fibers were secured with 4 skull screws and dental cement (Lang Dental Mfg).
Mice were treated with topical antibiotic and with carprofen (5mg/kg; s.c.; Rimadyl) immediately following surgery and 24 hr later. Mice were allowed 6 weeks for recovery before experiments began.
x 10 12 vg/mL), AAV1-FLEX-SaCas9-U6-sgTh (1.8 x 10 12 vg/mL), or AAV1-FLEX-SaCas9-U6-sgRosa26 (1.5 x 10 12 vg/mL) such that ChR2-YFP constituted 1/7 th of the total volume and the respective SaCas9 constituted 6/7 th of the total volume. 400nL of this mixture was injected into the VTA of VGLUT2cre mice (Distance from Bregma in mm: -3.4 AP; +0.35 ML; -4.4 DV) at 100nl/min using a glass pipette attached to a microinjector (Nanoject 2, Drummond Scientific). Following viral infusion, the injector tip was kept in place for 10 min before slowly retracting. For optogenetic self-stimulation experiments, optic fibers (200µm core; Newdoon) were subsequently placed bilaterally above NAc medial shell at a 10° medio-lateral angle (+1.4 AP; ±1.13 ML; -3.81 DV).
Optic fibers were secured with 4 skull screws and dental cement (Lang Dental Mfg).
Mice were treated with topical antibiotic and with carprofen (5mg/kg; s.c.; Rimadyl) immediately following surgery and 24 hr later. Mice were allowed 6 weeks for recovery before experiments began.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!