The largest database of trusted experimental protocols

Rna isolator total rna extraction reagent

Manufactured by Vazyme
Sourced in China

The RNA Isolator Total RNA Extraction Reagent is a laboratory product designed to efficiently extract total RNA from a variety of biological samples. It provides a simple and effective method for isolating high-quality RNA for downstream applications.

Automatically generated - may contain errors

26 protocols using rna isolator total rna extraction reagent

1

Quantifying Gene Expression by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from tissues and cell lines using RNA isolator total RNA extraction reagent (Vazyme, R401-01, China), and reverse transcription was performed using PrimeScript RT Master Mix (TaKaRa, Otsu, Japan) and subjected to SYBR Green quantitative real-time PCR using PCR Master Mix (Life Technology) following the manufacturers’ instructions. Q-PCRs were performed on an ABI 7500 real-time PCR system (Applied Biosystems, Waltham, MA, United States). The levels of expression were normalized to the actin levels. The relative expression was calculated using the 2−ΔΔCT method. The specific primer sequences are described in Table 1.
+ Open protocol
+ Expand
2

Comprehensive RNA Expression Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA of the tissue and cells was extracted using RNA Isolator Total RNA Extraction Reagent (Vazyme, China), and the RNA was reverse-transcribed by PrimeScript RT Master Mix (TaKaRa, Japan), according to the manufacturer’s instructions. The QPCR assay was tested by SYBR Green Mix (Life Technology, USA) and quantified by ABI 7500 Real-Time PCR System (Applied Biosystems, USA). The relative expression of each gene was normalized to Actin by the 2∆Ct method. The specific primer sequences are listed in Table 1.

Specific primer sequences

GeneForward primerReverse primer
ACTBCATGTACGTTGCTATCCAGGCCTCCTTAATGTCACGCACGAT
ALDOBTGTCTGGTGGCATGAGTGAAGGGCCCGTCCATAAGAGAAACTT
FBP1GAACCGGAGAAAAGGGGTAAATGTTCCAACGGACACAAGGCA
PFKMGGTGCCCGTGTCTTCTTTGTAAGCATCATCGAAACGCTCTC
PCK1AAAACGGCCTGAACCTCTCGACACAGCTCAGCGTTATTCTC
G6PC1CACTTCCGTGCCCCTGATAAAGTATACACCTGCTGTGCCC
TEFGCGAGACGCGCCTTGATAAATCGTAGGGGATGGTCTTGTC
PCK2GGCTGAGAATACTGCCACACTACCGTCTTGCTCTCTACTCGT
Forward primerUniversal reverse primerStem-loop
MIR514BGTTTTCTCAAGAGGGAGGCGTGCAGGGTCCGAGGTGTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACATGATT
MIR4477BGTTGGGATTAAGGACATTTGTGGTGCAGGGTCCGAGGTGTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACATCAAT
+ Open protocol
+ Expand
3

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from treated adult flies with RNA isolator total RNA extraction reagent (Vazyme Biotech Co. Ltd., Nanjing, Jiangsu, China). For RT-PCR, cDNA was prepared with a first-strand cDNA synthesis kit (Vazyme Biotech Co. Ltd., Nanjing, Jiangsu, China). The qPCR was performed in an ABI StepOne Plus real-time PCR system (Applied Biosystems, Foster City, CA, USA) with AceQ SYBR Green Master Mix (Vazyme Biotech Co. Ltd., Nanjing, Jiangsu, China). The mRNA expression levels were normalized to the rp49 control. All experiments were conducted in triplicate. The relative 2△△Ct method was used for data analysis [55 (link)]. All primers used in this analysis are listed in Supplementary Table S2. All qPCR data are reported as means ± SEM.
+ Open protocol
+ Expand
4

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from tissues and cell lines using the RNA isolator total RNA extraction reagent (R401-01, Vazyme, Nanjing, China), and reverse transcription was performed using the PrimeScript RT Master Mix (TaKaRa, Otsu, Japan) and subjected to an SYBR Green quantitative real-time PCR using the PCR Master Mix (Life Technologies, Austin, TX, USA), following the manufacturers’ instructions. Q-PCRs were performed on an ABI 7500 real-time PCR system (Applied Biosystems, Waltham, MA, USA). The expression levels were normalized to the actin levels. The relative expression was calculated using the 2 ∆∆Ct method. Detailed primer sequences are provided in Supplementary Table S1.
+ Open protocol
+ Expand
5

Total RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
A total RNA extraction was performed using Vazyme's RNA Isolator Total RNA Extraction Reagent (R401-01). RNA concentration and purity were detected by NanoDrop micro-spectrophotometer. The HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, R312-02) was used to synthesize first-strand cDNA with oligo dT as the reverse transcription primer. Quantitative PCR (qPCR) was performed using a BIO-RAD real-time PCR system and the Hieff qPCR SYBR Green Master Mix (Yeasen, 11201ES08). β-actin was used as the control gene for normalization. The relative quantitative expression of genes in each group was analyzed by 2−ΔΔCt and the relative expression was calculated. Table 1 displays the primer sequences.
+ Open protocol
+ Expand
6

SYBR-based qPCR for MMP2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA of each sample was isolated by RNA Isolator Total RNA extraction Reagent (R401‐01, Vazyme). The cDNA was synthesized with the HiScript II Q RT SuperMix (R223‐01, Vazyme) according to manufacturer's instructions, and real‐time PCR reaction was done with QuantStudio 7 Flex Real‐Time PCR system (Life Technologies) and ChamQ Universal SYBR qPCR Master Mix (Q711‐02, Vazyme). The amount of target mRNA (relative quantity, RQ) was determined using the ∆∆Ct method with GAPDH as the internal control with three replications. GAPDH‐F: GTCTCCTCTGACTTCAACAGCG. GAPDH‐R: CCACCCTGTTGCTGTAGCCAA. MMP2‐F: GATACCCCTTTGACGGTAAGGA. MMP2‐R: CCTTCTCCCAAGGTCCATAGC.
+ Open protocol
+ Expand
7

Quantification of Hepatic Apob Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA in livers was extracted with RNA isolator total RNA extraction reagent (Vazyme, Nanjing, China), and their complementary DNA (cDNA) was converted with HiScript Q RT SuperMix for polymerase chain reaction (PCR) (Vazyme, Nanjing, China). Then, the obtained cDNA was amplified with AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China), and relative expressions of Apob were quantified using a quantitative PCR (qPCR) detection system (CFX96, Bio-Rad, USA). Apob forward primer: 5′-TCCAGACAACCTCTTCCTAAAGAC-3′; Apob reverse primer: 5′-GGATGTCAATGTTTATTTTGTTCCT-3′.
+ Open protocol
+ Expand
8

GAPDH and SPAG9 Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using RNA Isolator Total RNA Extraction Reagent (Vazyme Biotech Co., Ltd, Nanjing, China) according to the manufacturer’s instructions. Reverse transcription was performed by HiScript Q RT SuperMix (Vazyme Biotech Co., Ltd, Nanjing, China). Quantitative PCR (qPCR) analysis was performed by AceQ qPCR SYBR Green Master Mix (Vazyme Biotech Co., Ltd, Nanjing, China). The sequences of the primers for PCR are as follows: 5’-GAAGGTGAAGGTCGGAGTC-3’ (forward) and 5’-GAAGATGGTGATGGGATTTCC-3’ (reverse) for GAPDH; 5’-CAAGGCGGATCTAAAGCTACC-3’ (forward) and 5’- TTGGCGCATCTGTAACCTTCA -3’ (reverse) for SPAG9.
+ Open protocol
+ Expand
9

RNA Extraction and RT-qPCR Analysis of HPV and Lipid Metabolism Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from cells using the RNA Isolator Total RNA Extraction Reagent (Vazyme Biotech Co., Ltd, Nanjing, China). Total RNA was reverse-transcribed with HiScript Q RT SuperMix (Vazyme Biotech Co., Ltd, Nanjing, China). Real-time quantitative PCR was performed using the AceQ qPCR SYBR Green Master Mix (Vazyme Biotech Co., Ltd, Nanjing, China). The primer sequences for PCR are presented in Table 2.

Sequences of specific primers for qPCR (F, Forward; R, Reverse)

TargetApplicationPrimer
HPV16 E6/E7RT-qPCRF: 5′- CAATGTTTCAGGACCCACAGG -3′ R: 5′- CTCACGTCGCAGTAACTGTTG -3′
HPGDRT-qPCRF: 5′- CTCTGTTCATCCAGTGCGAT -3′ R: 5′- TCACTCCAGCATTATTGACCA -3′
ACLYRT-qPCRF: 5′- CTCCTCTGCTCGATTATGCACT -3′ R: 5′- CTCCCGAGTAAAGGACCCACA -3′
FASRT-qPCRF: 5′- CGCCCACCTACGTACTGGCCTA -3′ R: 5′- GCTCCATGTCCGTGAACTGCT -3′
ELOVL6RT-qPCRF: 5′- TCTTCAGTATATTCGGTGCTC -3′ R: 5′- CTTAGCACAAATGCATAAGCC -3′
SCD1RT-qPCRF: 5′- CTACCTGCAAGTTCTACACC -3′ R: 5′- CAATGATCAGAAAGAGCCGTA -3′
β-actinRT-qPCRF: 5′- TTGCCGACAGGATGCAGAAGGA -3′ R: 5′- AGGTGGACAGCGAGGCCAGGAT -3′
+ Open protocol
+ Expand
10

Total RNA Extraction and 3' RACE

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using RNA Isolator Total RNA Extraction Reagent (Vazyme R401-01). For qRT-PCR, the first-strand cDNA was synthesized using the HiScript III 1st Strand cDNA Synthesis Kit (Vazyme R312-02) with oligo(dT) as reverse transcription (RT) primer. Quantitative PCR (qPCR) was performed using Hieff qPCR SYBR Green Master Mix (Yeasen).
For the 3′ RACE assay, cDNA was synthesized using anchored oligo(dT) (GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTTTVN) as RT primer. Then cDNA was amplified by nest PCR using gene specific forward primers and anchor reverse primer (anchor-R). PCR products were separated by agarose gel and purified by Gel DNA Exaction mini kit (Vazyme). Purified PCR products were sent for Sanger sequencing and visualized by SnapGene Viewer. Primer sequences were listed in Supplemental Table S3.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!