Thermal cycler dice

Manufactured by Takara Bio

Sourced in Japan, United States

The Thermal Cycler Dice is a laboratory instrument used for amplifying DNA samples through the process of polymerase chain reaction (PCR). It precisely controls the temperature, duration, and cycling of the reactions to facilitate the exponential replication of DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

Sybr premix ex taq 2, by Takara Bio (21 mentions) Trizol, by Thermo Fisher Scientific (21 mentions) Rneasy mini kit, by Qiagen (17 mentions) Trizol reagent, by Thermo Fisher Scientific (13 mentions) Primescript rt reagent kit, by Takara Bio (12 mentions) Primescript rt master mix, by Takara Bio (11 mentions) Thunderbird sybr qpcr mix, by Toyobo (11 mentions) Isogen, by Nippon Gene (10 mentions) Tb green premix ex taq 2, by Takara Bio (10 mentions) Sybr premix ex taq, by Takara Bio (9 mentions) Sybr premix ex taq 2 reagent, by Takara Bio (9 mentions) Sybr premix ex taq kit, by Takara Bio (8 mentions) Revertra ace qpcr rt master mix with gdna remover, by Toyobo (8 mentions) M mlv reverse transcriptase, by Promega (8 mentions) Ex taq polymerase, by Takara Bio (5 mentions) Superscript 3, by Thermo Fisher Scientific (5 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions) Reverse transcriptase, by Fujifilm (5 mentions) Sybr fast qpcr kit, by Roche (4 mentions) Geneamp rna pcr kit, by Thermo Fisher Scientific (3 mentions)

131 protocols using thermal cycler dice

Quantitative Analysis of Key Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were isolated from indicated tissues using TRIzol reagent (Invitrogen Corp). RNA samples were quantified based on A260/A280 ratios using a Thermo Scientific NanoDrop One spectrophotometer (Thermo Fisher Scientific). Samples with A260/A280 ratios >1.8 were considered pure and subjected to cDNA synthesis. A Prime Script RT reagent Kit (Takara Bio Inc) was used for reverse transcription of mRNA. cDNA was synthesized using a Thermal Cycler Dice (Takara Bio Inc) according to the manufacturer’s instructions.
Quantitative real-time PCR was performed using TB Green Premix ExTaq II reagent (Takara Bio Inc) and a Thermal Cycler Dice (Takara Bio Inc) according to the manufacturer’s instructions. β-actin (Actb) expression served as an internal control. Primers for real-time PCR were as follows.
mEnpp1-forward: 5′-AAGCATGGTGCTGAAGTTGACTC-3′
mEnpp1-reverse: 5′-TGGGATGACTTGGGTTGTAAATG-3′
Klotho-forward: 5′-GACAATGGCTTTCCTCCTTTACCT-3′
Klotho-reverse: 5′-TGCACATCCCACAGATAGACATTC-3′
Cyp27b1-forward: 5′-ACTCAGCTTCCTGGCTGAACTCTT-3′
Cyp27b1-reverse: 5′-GTAAACTGTGCGAAGTGTCCCAAA-3′
β-actin (Actb)-forward: 5′ – AAGTGTGACGTTGACATCCG-3′
β-actin (Actb)-reverse: 5′ – GATCCACATCTGCTGGAAGG -3′

Arima T., Sugimoto K., Taniwaki T., Maeda K., Shibata Y., Tateyama M., Karasugi T., Tokunaga T., Sueyoshi T., Hisanaga S., Masuda T., Uehara Y., Yugami M., Matsushita K., Yonemitsu R., Kawakami J., Yoshimura N., Tanimura S., Kato H., Ito N., Inoue K., Bando K., Nakamura T, & Miyamoto T. (2023). Cartilage tissues regulate systemic aging via ectonucleotide pyrophosphatase/phosphodiesterase 1 in mice. The Journal of Biological Chemistry, 300(1), 105512.

+ Open protocol

+ Expand

Tumor RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from cells of tumor tissues obtained from B16-OVA–bearing mice was extracted by using RNeasy Plus Micro Kit (QIAGEN, 74034), and the first-strand cDNA was synthesized from 100 ng of total RNA with oligo(dT)₂₀ primer using the PrimeScript RT Master Mix (Takara Bio, RR036A) according to the manufacturer's instructions. Transcriptional expression levels were analyzed, as described previously (26 (link)) by using SYBR Premix Ex Taq II (Takara Bio, RR820L) on Thermal Cycler Dice (Takara Bio) with specific primer pairs listed in Supplementary Table S2 after normalization for Gapdh expression by the 2^–ΔΔ^C_t method. Each sample contained three biological replicates.

Uto T., Fukaya T., Mitoma S., Nishikawa Y., Tominaga M., Choijookhuu N., Hishikawa Y, & Sato K. (2023). Clec4A4 Acts as a Negative Immune Checkpoint Regulator to Suppress Antitumor Immunity. Cancer Immunology Research, 11(9), 1266-1279.

+ Open protocol

+ Expand

Quantification of Gene Expression by qRT-PCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was extracted as described previously [8 (link)]. RNA was reverse transcribed in a 10 uL reaction system using the PrimeScriptTM RT Master Mix Kit (TaKaRa, Otsu, Japan). Gene-specific primers were designed base on the gene sequences using Primer 3.0 software and the primer sequences are listed in Table S10. The 18S rRNAgene of banana was used as a reference gene. The qRT-PCR was performed using the SYBR Premix Ex Taq Kit (TaKaRa, Otsu, Japan) according to the manufacturer’s protocol. And all qRT-PCR reactions were carried out using Thermal Cycler Dice (TaKaRa, Otsu, Japan). Individual reactions were run with each primer pair with annealing temperatures ranging from 55 to 60 °C. The conditions were as follows: initial holding at 95 °C for 3 min, followed by a two-step program of 95 °C for 10 s and annealing temperature for 30 s for 40 cycles. Each sample was analyzed in three technical replicates. The relative changes in gene expression levels were calculated using the2^−ΔΔCt method [49 (link)].

Niu Y., Hu B., Li X., Chen H., Takáč T., Šamaj J, & Xu C. (2018). Comparative Digital Gene Expression Analysis of Tissue-Cultured Plantlets of Highly Resistant and Susceptible Banana Cultivars in Response to Fusarium oxysporum. International Journal of Molecular Sciences, 19(2), 350.

+ Open protocol

+ Expand

Quantitative Analysis of Renal Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from kidneys was converted to cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo, Osaka, Japan). Quantitative amplification of cDNA was performed with the Thermal Cycler Dice (TaKaRa Bio, Shiga, Japan) using SYBR Premix EX Taq II (TaKaRa Bio). PCR primer sequences are as follows: endogenous mouse renin gene (5'-GCCCTCTGCCACCCAGTAA-3' and 5'-CAAAGCCAGACAAAATGGCCC-3'), mRen Tg (5'-CATCCACCGGATCTAGATAAC-3' and 5'-CAAAGCCAGACAAAATGGCCC-3'), hREN Tg (5'-GCTTTCTCAGCCAGGACATC-3' and 5'-TGCCAATGGCCTGTTCAATG-3'), and mouse Gapdh gene (5'-AAAATGGTGAAGGTCGGTGTG-3' and 5'-TGAGGTCAATGAAGGGGTCGT-3').

Ushiki A., Matsuzaki H., Ishida J., Fukamizu A, & Tanimoto K. (2016). Long-Range Control of Renin Gene Expression in Tsukuba Hypertensive Mice. PLoS ONE, 11(11), e0166974.

+ Open protocol

+ Expand

Quantification of Fbxo47 Expression in Testes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from tissues and embryonic gonads using TRIzol (Thermo Fisher). cDNA was generated from total RNA using Superscript III (Thermo Fisher) followed by PCR amplification using Ex-Taq polymerase (Takara) and template cDNA.
For RT-qPCR, total RNA was isolated from WT (n = 3) and Meiosin KO (n = 3) testes, and cDNA was generated as described previously (Ishiguro et al., 2020 (link)). Fbxo47 cDNA was quantified by ΔCT method using TB Green Premix Ex Taq II (Tli RNaseH Plus) and Thermal cycler Dice (Takara), and normalized by GAPDH expression level.
qPCR was performed in duplicates, and the average ddCt value was calculated for each cDNA sample. The expression level of Fbxo47 was divided by that of GAPDH to give the relative expression level of Fbxo47 to GAPDH. Relative expression level of Fbxo47 to GAPDH was normalized to 1 for a given P10 WT sample.
Sequences of primers used for RT-PCR were as follows:
GAPDH-F: 5’-TTCACCACCATGGAGAAGGC-3’
GAPDH-R: 5’-GGCATGGACTGTGGTCATGA-3’
Gapdh_F2: 5’-ACCACAGTCCATGCCATCAC-3’
Gapdh_R2: 5’-TCCACCACCCTGTTGCTGTA-3’
Gapdh_Ex6F: 5’-GGTTGTCTCCTGCGACTTCA-3’
Gapdh_mRNAR: 5’-GCCGTATTCATTGTCATACCAGG-3’
Fbxo47-F 1443F: 5’-GCATAGCAAATGCTTTTGCCTGTG-3’
Fbxo47-R 1605R: 5’-GAGATAGCGTTCATGGTCAGATAC-3’
Primer sequences are listed in Table S1.

Tanno N., Takemoto K., Takada-Horisawa Y., Shimada R., Fujimura S., Tani N., Takeda N., Araki K, & Ishiguro K.I. (2022). FBXO47 is essential for preventing the synaptonemal complex from premature disassembly in mouse male meiosis. iScience, 25(4), 104008.

+ Open protocol

+ Expand

RNA Extraction and qPCR for Galectin-1 and Survivin

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using Trizol reagent (MRC, Cincinnati, OH), and subsequent RT-PCR was carried out using ReverTra Ace^® qPCR RT Master Mix (TOYOBO). Quantitative real-time PCR was performed with a SYBR FAST qPCR kit (KAPA) in a Thermal Cycler Dice (Takara, Otsu, Shiga, Japan) according to the manufacturer's instructions. The C(t) value was normalized using GAPDH as a control. The following primers were used: GAPDH (FWD: 5′-TCA GTG GTG GAC CTG ACC TGA CC-3′, RV: 5′-TGC TGT AGC CAA ATT CGT TGT CAT ACC-3′), galectin-1 (FWD: 5′-CAA CCC TCG CTT CAA CGC CCA CG-3′, RV: 5′-CGT ATC CAT CTG GCA GCT TGA CGG-3′), and survivin (FWD: 5′-CTT GGA GGG CTG CGC CTG CAC CC-3′, RV: 5′-CTG GCT CCC AGC CTT CCA GCT CCT TG-3′).

Nam K., Son S.H., Oh S., Jeon D., Kim H., Noh D.Y., Kim S, & Shin I. (2017). Binding of galectin-1 to integrin β1 potentiates drug resistance by promoting survivin expression in breast cancer cells. Oncotarget, 8(22), 35804-35823.

+ Open protocol

+ Expand

Quantitative PCR Assay for Globin Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from phenyl hydrazine-induced anemic adult spleens (1 to 2 months old) or fetal liver (e14.5) by ISOGEN (Nippon Gene) and converted to cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO). One-fortieth of the reaction mixture was subjected to quantitative PCR amplification using the KOD SYBR qPCR Mix (Toyobo) and thermal Cycler Dice (TaKaRa Bio) with the following parameters: 95°C for 5s and 60°C for 30s, 40 cycles. The PCR primer sets used for human β(γ)- or β(ε)-globin genes amplification were GM-1S2 and BT-3A3 (126-bp amplicon) or BT-1S3 and EP-3A (152-bp), respectively. Primer set common to both β(γ)- and β(ε)-globin genes amplification was BT-4S1 and BT-4A1.
The primer sets used for mouse endogenous gene expression analyses were as follows:

Tanimoto K., Matsuzaki H., Okamura E., Ushiki A., Fukamizu A, & Engel J.D. (2019). Transvection-like interchromosomal interaction is not observed at the transcriptional level when tested in the Rosa26 locus in mouse. PLoS ONE, 14(2), e0203099.

+ Open protocol

+ Expand

Quantitative Analysis of Lineage-Specific Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with RNeasy Mini Spin columns (Qiagen, Valencia, CA) and was subjected to reverse transcription using the Prime Script RT–PCR kit (Takara). Real-time RT–PCR analysis was performed using SYBR Premix Ex TaqII and Thermal Cycler Dice (Takara). Data are represented as the means ± s.d. from a minimum of three independent experiments. A panel of 7 genes involved in osteogenic, or chondrogenic, or adipogenic differentiation were selected. The sequences of the primers and probes have been described previously.

Yang Y., Yang R., Roth M., Piperdi S., Zhang W., Dorfman H., Rao P., Park A., Tripathi S., Freeman C., Zhang Y., Sowers R., Rosenblum J., Geller D., Hoang B., Gill J, & Gorlick R. (2017). Genetically transforming human osteoblasts to sarcoma: development of an osteosarcoma model. Genes & Cancer, 8(1-2), 484-494.

+ Open protocol

+ Expand

Plasma and Salivary miRNA Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

From the collected plasma and salivary samples, miRs were extracted using trizol and chloroform, and were purified using a spin column method (Qiagen, Hilden, Germany). The cDNAs were synthesized with the miScript II RT Kit (Qiagen, Hilden, Germany), using Takara Thermal Cycler Dice (Takara, Shiga, Japan), and utilized for the miR PCR array (Qiagen, Hilden, Germany), which quantifies 84 miRs that are most abundantly expressed in circulation using real time quantitative PCR (RT-qPCR) (Applied Biosystems, Carlsbad, CA, USA). The reaction mixtures were activated at 95 °C for 5 min, followed by 40 cycles of denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s, and extension at 72 °C for 30 s. After amplification, the PCR products were confirmed through melting curve analysis. RNA U6 small nuclear gene (RNU6), which is the most commonly used internal control gene in miRNA RT-qPCR assays, was used as the reference gene, and the Ct values from each miR were normalized to the Ct value of RNU6.

Shin P.K., Kim M.S., Park S.J., Kwon D.Y., Kim M.J., Yang H.J., Kim S.H., Kim K., Chun S., Lee H.J, & Choi S.W. (2020). A Traditional Korean Diet Alters the Expression of Circulating MicroRNAs Linked to Diabetes Mellitus in a Pilot Trial. Nutrients, 12(9), 2558.

+ Open protocol

+ Expand

Quantitative Analysis of Anemic Spleen RNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was recovered from phenylhydrazine treated anemic adult spleens (1–2 months old) of Δ5 YAC TgM using ISOGEN (Nippon Gene) and converted to cDNA using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO). Quantitative amplification of cDNA was performed with the Thermal Cycler Dice (TaKaRa Bio) using TB Green Premix EX TaqII (TaKaRa Bio). PCR primers were reported previously (27 (link)).

Matsuzaki H., Takahashi T., Kuramochi D., Hirakawa K, & Tanimoto K. (2023). Five nucleotides found in RCTG motifs are essential for post-fertilization methylation imprinting of the H19 ICR in YAC transgenic mice. Nucleic Acids Research, 51(14), 7236-7253.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!