M mlv reverse transcription system

Total RNA was extracted from pupal brains as reported in Chen et al. [17 (link)], 1 μg of total RNA was reverse transcribed at 37°C for 1 h using M-MLV reverse transcription system (Promega, USA). One μl of reverse transcription product was added to 20 μl of the PCR reaction system, and amplification was performed with degenerate primers designed according to the conserved HK cDNA sequences from Bombyx mori (GenBank accession no. XP-004932651.1), Danaus plexippus (GenBank accession no. EHJ75730.1) and Drosophila melanogaster (GenBank accession no. NP_-727350.1). PCR was performed under the following conditions: 5 min at 94°C; 30 cycles of 30 s at 94°C, 30 s at 42°C, and 60 s at 72°C; and 5 min at 72°C. A 530 bp of PCR product for HK was obtained and sequenced.
For 5′- and 3′-RACE, the first strand cDNA (Fs-cDNA) was synthesized using the SMART RACE cDNA amplification kit, according to the manufacturer's protocols (Clontech, USA). Two primers ACACGCACTCGCATACGTGGC and CACTCGCGT GCGACAATCC for HK 5′-RACE, and two primers CTCATCGTTGGCACTGGCAGC and GAGTTCGAC CGCGAAGTCGAC for HK 3′-RACE, were respectively synthesized. Using nest PCR, 5′- and 3′-HK cDNAs were respectively amplified as described in Xu [26 (link)].

Total RNA in cucumber leaves was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. Residual DNA was digested by DNase I (Sigma-Aldrich). 2.0 μg of total RNA was used as the template for first-strand cDNA synthesis using M-MLV Reverse Transcription System (Promega). Real-time PCR was then performed using gene-specific primers (S1 Table) and Roche Power SYBR^® Green Real-time PCR Master Mix with a Light Cycler^® 96 system (Roche Diagnostics, Basel, Switzerland). The relative transcript abundance was calculated using the comparative C_t method. The house-keeping gene Actin was used as a standard reference. Each sample was run in triplicate.

RNA was extracted using TRIzol reagent (Invitrogen). Reverse transcription was performed using the M-MLV Reverse Transcription System (Promega). Stem-loop reverse transcription for mature miR-101 and U6 primers was performed as previously described [16 (link)]. U6 RNA was used as a miRNA internal control. The primers used for stem loop reverse-transcription PCR for miR-101 were purchased from RIBOBIO (Guangzhou, China). qRT-PCR was performed using a standard SYBR-Green PCR kit protocol on a StepOne Plus system (Applied Biosystems, CA), and β-actin was used as the endogenous control to normalize the relative amount of total mRNA in each sample. The primer sequences are summarized in Table 4. qRT-PCR reactions were performed in triplicate and included no-template controls. Relative expression was calculated using the comparative Ct method.

RNA was prepared on days 2, 10, 14 and 21 after plating during the differentiation time course using the RNeasy Mini Kit (Qiagen). RNA from all time points was reverse transcribed side-by-side using the M-MLV Reverse Transcription System (Promega). Quantitative RT–PCR reactions were run in duplicate using cDNA (diluted 1:10), 300 nM primers16 (link), and iQ SYBR Green Supermix (Bio-Rad) with the iQ5 Multi-Color Real-Time PCR Detection System (Bio-Rad), using β-actin as the housekeeping gene. Primer sequences are as follows: WT1 5′-GGGTACGAGAGCGATAACCA-3′, 5′-TCTCACCAGTGTGCTTCCTG-3′, SIX2 5′-CTGGAGAGCCACCAGTTCTC-3′, 5′-GCTGCGACTCTTTTCCTTGA-3′, LHX1 5′-ATCCTGGACCGCTTTCTCTT-3′, 5′-GTACCGAAACACCGGAAGAA-3′, OCT4 5′-CAGTGCCCGAAACCCACAC-3′, 5′-GGAGACCCAGCAGCCTCAAA-3′.

Relative expression levels of selected genes were determined by qRT-PCR by using total RNA samples isolated from the leaves or leaf sheath tissues of parent or ratoon plants. Total RNA was isolated using the RNAiso Plus reagent (Takara, Japan) according to manufacturer’s instructions. First-strand cDNA was synthesized from 1 µg of total RNA using MMLV-reverse transcription system (Promega, Madison, WI, USA) according to the manufacturer’s instructions. The qRT-PCR reactions were performed using the SYBR Premix EX TaqTM master mix (TaKaRa). The rice actin gene OsActin (GenBank accession no. X15865) was used as an internal standard to normalize cDNA concentrations. Reactions were performed using DNA Engine Opticon 2 Continuous Fluorescence Detection Syleaf sheaths (MJResearch Inc., Waltham, MA, USA). Gene specific primer sequences used for these experiments are listed in Table S1. The relative expression levels for genes of interest were calculated using the double-standard curves method. For qRT-PCR analysis, five independent biological samples were used. Reaction conditions for thermal cycling were as follows: 95°C for 1 min, 40 cycles of 95°C for 20 s and 58–60°C for 15 s.