Gelstar nucleic acid gel stain

RNA was isolated from iPSC, NSC, neuronal, and AT/RT cell lines with a Qiagen RNeasy kit (Qiagen, 74104) and reverse transcribed with the SuperScript First-Strand Synthesis RT-PCR kit (ThermoFisher Scientific, 11904018). Polymerase chain reactions were used to amplify HML-2 envelope transcripts with primers which target the full length env transcript (Table 1). Q5 high fidelity 2X master mix was used for the PCR with the following cycling conditions: 98 °C for 90 s, [98 °C 10 s, 55 °C 20 s, 72 °C 4 min] repeat 34 times, final extension at 72 °C for 6 min, 4 °C forever. The PCR primers were used to amplify the full length env gene as following: forward primer 5’- cccactagacatttgaagttctaca-3’, and reverse primer 5’- ggagtctcctatgtctacttcttt-3’. One primer aligned to the 3’ LTR of the HML-2 element and the other primer was positioned 5’ (upstream) of the start of the env gene. For the AT/RT cells, we cloned products into Topo-TA vectors (ThermoFisher Scientific, K203001) and sent them for Sanger sequencing to determine which env loci were actively transcribed in the samples. For the iPSCs, NSCs, and neurons, PCR products were run in a 2% agarose gel with GelStar Nucleic Acid Gel stain (Lonza, 50535) and the gel was imaged using Flourchem Protein Simple imager.

Multiplexed pthlha gRNAs and Cas9 protein were co-injected into one-cell-stage wild-type embryos as previously described. At 24 hpf, 14 injected and 14 uninjected embryos were each placed into PCR tubes containing 35 μl of 50 mM NaOH. Genomic DNA was extracted by incubation at 98°C for 20 min and then neutralized with the addition of 5 μl of 1 M Tris pH 8.0. Each extracted genomic DNA sample was used as template in four PCR reactions to amplify each target site (see Table S1 for primer sequences). PCR products were then run on 10% native PAGE gels and stained with GelStar Nucleic Acid Gel Stain (Lonza, 50535) (Ota et al., 2013 (link)).

Total RNA was extracted and purified with the SV total RNA isolation system (Promega) with the spin protocol recommended by the manufacturer. 50 mg of BYMV-infected leaves from broad bean leaves were ground in liquid nitrogen using a mortar and pestle and stored at −20°C until extraction (Duraisamy et al., 2011 ).
Following total RNA extraction, the QIAGEN Single Step RT-PCR Kit (Qiagene, Hilden, Germany) was used for virus identification. To amplify the BYMV genome, primers were designed and evaluated from the coat protein region by reverse transcription-polymerase chain reaction (RT-PCR). The forward 5′CAGTTTATTATGCAGCGG3′ and reverse 5′GTTATCATCAATCTTCCTGC3′ primers were used according to Hiroyuki and Tsuda (2005 (link)). The RT-PCR products were separated on 1% agarose gels in 0.5X TBE buffer, stained with the GelStar nucleic acid gel stain (Lonza, USA) and visualized by UV illumination using Gel Documentation System (Gel Doc 2000, Bio-Rad, USA). Fragments were sized using a 100 bp marker.

A 3% 3–1 NuSieve agarose gel (Lonza, Switzerland, cat.no. 50090) was made according to the laboratory protocol with 1x TAE buffer diluted from 50x TAE buffer (Qiagen, cat.no. 129237). For visualization of qPCR products, 10% non-toxic GelStar Nucleic Acid Gel Stain (Lonza, cat.no. 50535) was added to the melted agarose before pouring the solution into a plastic well with combs. After gel solidification the combs were removed and the solid gel transferred to an electrophoresis tank (BioRad, CA, USA) and covered with 1 x TAE buffer. For every 8 μl PCR product, 2 μl Gelpilot 5x loading dye (Qiagen, cat.no. 1037650) was added and the 10 μl sample is loaded by directly injecting into the wells. A negative control was included to show no contamination of the product. Gelpilot 1 kb ladder (Qiagen, cat.no. SM0318) were used. The gel was run between 70 and 100 volt in 45 min.– 60 min. and visualized under ultraviolet light.

Single colony NB dilutions were used as template for PCR amplification of the16S rRNA gene and of the methylxanthine N1-demethylase gene, ndmA. Primers used for 16S rRNA amplification were 27F (5′- AGA GTT TGA TCM TGG CTC AG-3′) and 1392R (5′- ACG GGC GGT GTG TAC A-3′), and for ndmA were CBBcdmF (5′- TGG CAT CCC GTW TGT ACY GT-3′) and CBBcdmR (5′- CTT GKA TAA CRA TTC GCA ACC-3′) (Ceja-Navarro et al., 2015 ). Twenty-five microliter PCR reactions contained 3 μl of diluted NB isolate culture, 0.4 μM of each primer and 1X AmpliTaq Gold PCR Master Mix (6.25 U AmpliTaq Gold DNA polymerase, 2.5 mM MgCl₂, and 200 μM of each dNTP; Applied Biosystems/Life Technologies, Carlsbad, CA, United States). PCR amplification was conducted in an Eppendorf Mastercycler Gradient thermal cycler (Eppendorf, Westbury, NY, United States). The amplification program consisted of an initial 5 min denaturation step at 95° C, followed by 35 cycles at 95°C for 30 s, 54°C for 30 s, and 72°C for 1 min; and a final extension step at 72°C for 10 min. Following amplification, PCR products were electrophoresed on 1% agarose gels containing 1X TAE and 1X GelStar Nucleic Acid Gel Stain (Lonza Rockland Inc., Rockland, ME, United States), and documented using UV transillumination to detect 16S rRNA and ndmA bands.

DNA was extracted using a TIANamp Blood DNA kit (TIANGEN^®, China) following the manufacturer’s protocol. PCR to detect Babesia spp. was performed using Phusion High-fidelity DNA Polymerase (Thermo Scientific, MA, USA) with previously reported Babesia spp.-specific primers targeting the 18S rRNA gene: BAB1w (5′-GAA CCT GGT TGA TCC TGC CAG T-3′) and BAB2w (5′-GAT CCT TCT GCA GGT TCA CCT A-3′) [20 ]. The PCR was performed in a Peltier thermal cycler (model PTC-200; BioRad, California, USA) programmed to run at 98°C for 30 s, followed by 40 cycles of 98°C for 30 s, 58°C for 30 s, and 72°C for 90 s, ending with a final extension of 72°C for 5 min[20 ]. The PCR products were visualized by 1.5% agarose with iMyRun.N (Cosmo Bio, Japan) for electrophoresis using GelStar™ Nucleic Acid gel stain (Lonza, Switzerland).