Ask1 shrna

The ASK1 shRNA and scrambled shRNA were purchased from Santa Cruz Biotechnologies (Santa Cruz Biotechnologies, Dallas, Texas, USA). The ASK1 shRNA Plasmid (h) is a pool of 3 different shRNA plasmids with the following hairpin sequences: GATCCGTACCTCAAGTCTATTGTATTCAAGAGATACAATAGACTTGAGGTACTTTTT, GATCCCAAGGCATTCATACTGAAATTCAAGAGATTTCAGTATGAATGCCTTGTTTTT, and GATCCGGAAGGCTATCATTGACTTTTCAAGAGAAAGTCAATGATAGCCTTCCTTTTT. All sequences are provided in 5′→3′ orientation. shRNA was transfected into cells using VigoFect (Vigorous Biotechnology, PRC) following protocols provided by the manufacturer. Briefly, 2 × 10⁵ cells were seeded into six-well plates and grown to 40–60% confluence. The medium was renewed 1 h before transfection. The mixture of 10 μl of shRNA (1 μg) diluted in 90 μl of normal saline and 1 μl of VigoFect diluted in 99 μl of normal saline was added dropwise to the medium. At 48 h post-transfection, the medium was replaced with fresh selective medium containing 1 μg/mL puromycin (Santa Cruz Biotechnologies) to screen for stably transfected cells. The cultures were replaced with fresh selective medium every two days until no cells were killed.

For transfection studies, we transfected MLE-12 cells with either control shRNA or ASK-1 shRNA for 36 hours using Lipofectamine 2000-plus as per manufacturer's protocol (Invitrogen, Carlsbad, CA). Similarly, we transfected MLE-12 cells with plasmid overexpressing SOCS-1 for 36 hours using Lipofectamine 200-plus as described previously [25 (link)]. Briefly, we seeded a confluent culture (90%) of MLE-12 cells in six-well plates and then transfected cells with 4 μg of plasmid DNA. The medium was changed every 12 hours after post-transfection. The non-targeted β-Gal shRNA used as a control (sense sequence, UUAUGCCGAUCGCGUCACAUU) was obtained from Santa Cruz and ASK-1 shRNA (catalog number sc-29748) was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). MLE-12 cells were transfected with either control or ASK-1 shRNA using DharmaFECT following the manufacturer's protocol (Dharmacon, Lafayette, CO). 36–48 hours post-transfection, cells were harvested and the prepared cell lysates were then used for protein estimation (Biorad reagent).