The largest database of trusted experimental protocols

27 protocols using sirna2

1

CDCA2 Knockdown and Overexpression Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
Negative control (NC) and small interfering RNAs (siRNAs) of CDCA2 were constructed by GenePharma Corporation (Shanghai, China). The siRNA sequences of CDCA2 were as follows: siRNA1, 5′-CACCUGCCUUUCUAAAUAUTT-3′; siRNA2, 5′-GGGCAAAGGAUCAAGUGAUTT-3′; siRNA3, 5′-CUGCCUUGGAAAGGAUUGATT-3′. Transfection was performed with Lipofectamine 3000 (Invitrogen) following the manufacturer’s instructions. The assays were performed 48 h after transfection to assess the knockdown efficiency. A CDCA2 inhibitor lentivirus (shCDCA2) was then constructed according to siRNA1. To upregulate the expression of CDCA2 in DLD-1 cells, mammalian expression plasmids (pReceiver-M02-CDCA2) designed to specifically express CDCA2 were obtained from GeneCopoeia (Rockville, MD, USA).
+ Open protocol
+ Expand
2

siRNA Knockdown of Hepcidin in Cardiomyocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Two pairs of small-interfering RNAs (siRNA1 and siRNA2) were synthesized by Invitrogen Life Technology (Invitrogen). siRNA2 was employed to knock-down hepcidin levels and siRNA1 was injected s the negative control. Cultured human cardiomyocytes were transfected with each siRNA (20 μM) using Lipofectamine RNAiMAX (Invitrogen) as per the manufacturer’s instructions. After 48 h, protein was extracted for western blot analysis.
+ Open protocol
+ Expand
3

Overexpression and Knockdown of PinX1 in Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
PinX1 was cloned into the pcDNA3.1 (+) vector (Invitrogen, USA); the plasmid pcDNA3.1-PinX1 and empty vector were prepared using the QIAGEN Plasmid Midi Kit (QIAGEN, Germany). Then reconstructed and empty vector were transfected separately into the breast cancer cells by Lipofectamine 2000 (Invitrogen, USA) and a fresh cell culture medium containing 700 μg/mL, 1200 μg/mL, and 600 μg/mL of G418 (Amresco, USA) was applied 24 hours after transfection to MCF-7, MDA-MB-231, and SK-BR-3 accordingly. 3 weeks after the G418 screening, the cell clones were harvested using an Eclipse Ti-s (Nikon, Japan) microscope. The cell clones of pcDNA3.1-PinX1 group and empty vector group were maintained in the culture medium with 300 μg/mL of G418, and those with a high expression level of PinX1 were selected for later uses. Three different PinX1 siRNA fragments and siRNA NC were designed and synthesized by Ribbio (Guangzhou, China); the sequences were as follows: siRNA1, sense 5′-GGAGCCACAGAUCAUAUUA dTdT-3′, antisense 3′-dTdT CCUCGGUGUCUAGUAUAAU-5′; siRNA2, sense 5′-GGAGUAAUGACGAUUCCAA dTdT-3′, antisense 3′-dTdT CCUCAUUACUGCUAAGGUU-5′; siRNA3, sense 5′-GGACGCUACACUAGAAGAA dTdT-3′, antisense 3′-dTdT CCUGCGAUGUGAUCUUCUU-5′. MCF-10A cells were transfected separately with the three siRNAs and siRNA NC by Lipofectamine 2000 (Invitrogen, USA) to knockdown the PinX1.
+ Open protocol
+ Expand
4

Hypoxia-induced SH-SY5Y cell model

Check if the same lab product or an alternative is used in the 5 most similar protocols
SH-SY5Y cells (ATCC) were incubated in Dulbecco’s modified Eagles’s medium (DMEM; Hyclone, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, USA) at 37°C in a humidified atmosphere with 5% CO2. HEK-293T cells were cultured in RPMI-1640 medium (Gibco, Grand Island, NY, USA) supplied with 10% fetal bovine serum, 100U/ml penicillin, and 100 μg/ml streptomycin, at 37°C in a 5%CO2 atmosphere.
For OGD model, the SH-SY5Y cells were incubated in serum and sugar-free artificial cerebrospinal fluid at 37°C in an atmosphere of 1% O2, 94% N2 and 5% CO2 for 4 h and then incubated in DMEM medium in normoxic atmosphere.
In addition, miR-19a mimics, miR-19a inhibitor and their scramble controls were obtained from Guangzhou RiboBio Co., Ltd. (Guangzhou, China). The siRNAs (named as siRNA-1, siRNA-2 and siRNA-3) directed against H19 and negative control H19 scramble were purchased from Invitrogen Life Technologies (Waltham, MA, USA). The sequences of siRNAs were listed in Table 1.
+ Open protocol
+ Expand
5

Knockdown of TPD52L2 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Negative-control siRNA (siCon) and three other TPD52L2-targeting siRNAs, i.e., siRNA-1, siRNA-2, and siRNA-3, were specifically generated by GenePharma Company (Shanghai, China). The TPD52L2 siRNA contains the following nucleotide sequences: siRNA-1, 5′-GCGGAGGGTTTGAAAGAATAT-3′, siRNA-2, 5′-GACCATAAAGTCTAAGGTTGT-3′, and siRNA-3, 5′-CTTGGAGACATGAGGAACTCT-3′ besides siCon, 5′-CAGAAGGCAGGCCTCGATAT-3′. Lipofectamine 2000 (Invitrogen, USA) was employed for the transfection of TPD52L2 siRNAs or siCon, following the guidelines provided by the manufacturer.
+ Open protocol
+ Expand
6

Stealth™ RNAi Knockdown in C2C12 Myoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following Stealth™ RNAi constructs were used siRNA1 (5′‐GGAAGAUCUAAAUGCCCAAGUUGAA‐3′) and siRNA2 (5′‐CAUGCAAGAAGGCAGAAGUUACAAA‐3′) (Invitrogen, Mulgrave, AUS). For the myoblast experiments, C2C12 myoblasts were transfected at 40–50% confluence using the Stealth™ RNAi duplexes or a Stealth™ RNAi negative control duplex (Invitrogen) with a 40% G/C content and lipofectamine RNAiMAX (Invitrogen), according to manufacturer's instructions. The final concentration of both Stealth™ RNAi duplexes and the negative control was 10 nmol/L. Twenty‐four hours posttransfection, myoblasts were treated with palmitate or vehicle as described above. The timing of transfection and palmitate treatment was optimized such that myoblasts were still actively proliferating and subconfluent at end of the experiments. For the myotube experiments, to minimize the potentially confounding effects of palmitate (Grabiec et al. 2015) and Seps1 knockdown on myogenic differentiation, cells were differentiated for 72 h prior to transfection, and then 48 h posttransfection, myotubes were treated with differentiation media containing 0.35 mmol/L palmitate or vehicle as described above.
+ Open protocol
+ Expand
7

ATG5 Knockdown in A549 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
A549 cells were transfected with ATG5 small interfering RNA (siRNA-1; oligo ID HSS114103 and siRNA-2; oligo ID HSS190366; Invitrogen, Carlsbad, CA, USA) using Lipofectamine 2000 transfection reagent (Invitrogen) according to manufacturer's instructions. At 36-h post transfection, the knockdown efficiency at protein level was determined by immunoblotting and cell viability test. Scrambled siRNA (Invitrogen) was used as negative control.
+ Open protocol
+ Expand
8

TSHZ2 Overexpression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
pDsRed-monomer-C1-tagged human TSHZ2 was purchased from Clontech and kindly provided by Kasai K from Aichi Medical University School of Medicine, Nagakute 22 (link). PC9 cells were transfected with pDsRed-monomer-C1-TSHZ2 or pDsRed-monomer-C1-vector in 6-well plates (200,000 cells per well). The siRNAs targeting TSHZ2 (siRNA1: 5′-GAGGCCUGCAAGUCCCAGAUCUUAA′-3; 5′-UUAAGAUCUGGGACUUGCAGGCCUC-3′. siRNA2: 5′-CCACAAGAGCGUAUGCAAAUCUCUA-3′, 5′-UAGAGAUUUGCAUACGCUCUUGUGG-3′. siRNA3: 5′-CAUUUGUGAGCAAACAUGCGGUAAA-3′, 5′-UUUACCGCAUGUUUGCUCACAAAUG-3′) and negative control siRNA were purchased from Invitrogen (Thermo Fisher Scientific, Waltham, MA, USA). A549 cells were transfected with siRNA duplexes (1-2 μg) in 6-well plates (200,000 cells per well). In addition, we found that siRNA1 had the best down-regulating effect on TSHZ2 at the preliminary pre-experiment, so we used it in subsequent experiments. At 72 h after pDsRed-monomer-C1-TSHZ2 or siRNA-TSHZ2 treatment, protein or cells were gathered for testing and verification by requisite assays.
+ Open protocol
+ Expand
9

Knockdown of NRF2 in HCV-infected Huh-7.5 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Persistently HCV-infected Huh-7.5 cells were cultured in 6-well plates (up to 60% confluence in DMEM supplemented with 10% FBS media) without antibiotics. The next day, culture media was replaced with fresh DMEM with 2% FBS and cells were then transfected with siRNA to either NRF2 (siRNA1: 5′-GAAUGGUCCUAAAACACCA-3′, siRNA2: 5′-UGACAGAAGUUGACAAUUA-3′) synthesized by Invitrogen [80 (link),81 (link)] or scramble siRNA (Invitrogen) using Lipofectamine (Life Technology, Grand Island, NY, USA). The knockdown efficiency was analyzed by Western blot.
+ Open protocol
+ Expand
10

Silencing p38δ in Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lipofectamine RNAiMAX reagent, Opti-MEM medium and p38δ siRNAs (siRNA-#1: Cat No142319 and siRNA-#2: Cat No 142320) were obtained from Invitrogen. p38δ siRNAs or AllStar siRNA (Qiagen) as a negative control were transfected into MCF-7 or MDA-MB-231 cells (20 nM) according to the manufacturer’s protocol. Forty-eight hours after transfection, cells were used for the indicated experiments.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!