The specific siRNAs for LINCC00115 were synthesized from Sangon Biotech (Shanghai, China), and miR‐7 mimics were purchased from GenePharma (Shanghai, China). BT20 cells were cultured in six‐well plates up to 70% convergence and transfected with the siRNAs or miR‐7 mimics using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instruction. The sequences of the siRNAs are shown as follows: siRNA1, 5′‐AAGGATGACCTGGATTGTCCT‐3′; and siRNA2, 5′‐AACACCGACAGTGAAGGAGAG‐3′.
Mir 7 mimic
Manufactured by GenePharma
Sourced in China
MiR-7 mimics are a type of lab equipment used in molecular biology and genetics research. They are small, synthetic RNA molecules designed to mimic the function of the natural microRNA (miRNA) molecule miR-7. The core function of MiR-7 mimics is to facilitate the study of miR-7 expression and regulation in various biological systems.
Automatically generated - may contain errors
Lab products found in correlation
Mir 7 inhibitor, by GenePharma (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (1 mentions)
Scrambled shrna, by GeneCopoeia (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Mimic control, by GenePharma (1 mentions)
Inhibitor control, by GenePharma (1 mentions)
Pgl3 control vector, by Promega (1 mentions)
Lipofectamine 2000, by Promega (1 mentions)
Phusion site directed mutagenesis kit, by Thermo Fisher Scientific (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Si cdr1as, by GenePharma (1 mentions)
Si gdf5, by GenePharma (1 mentions)
Sirnacontrol si nc, by GenePharma (1 mentions)
Mir nc, by GenePharma (1 mentions)
6 protocols using mir 7 mimic
1
siRNA Transfection Protocol for LINC00115
2
MiR-7 Transfection in NPC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NPC cells were transfected with miR-7 mimics (Genepharma, Shanghai, China) or a non-specific control using Lipofectamine RNAiMAX reagent (Invitrogen, Thermo Fisher Scientific) following the manufacturer’s protocol. miR-7 mimics: sense 5′-UGG AAG ACU AGU GAU UUU GUU GU-3′; antisense 5′-AAC AAA AUC ACU AGU CUU CCA UU-3′. After the indicated periods of incubation, the cells were subjected to further analysis as described under the results section.
3
Transfection of miRNA and shRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
miR-7 mimics and miRNAs negative control (NC) were purchased from GenePharma, Inc. HOXB13 specific shRNA (HOXB13-shRNA) and scrambled shRNA which was used as a negative control were purchased from GeneCopoeia, Inc. The transfections of plasmids (2.5 µg) and miRNAs (10 pmol) were carried out using Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the protocol. At 48 h following transfection, subsequent experimentation was performed.
4
miR-7 Regulation of MRP1 and BCL2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The control mimic, miR-7 mimic, control inhibitor, and miR-7 inhibitor were purchased from GenePharma (Shanghai, China) and transfected into MCF-7 and MDA-MB-231 cells using the Lipofectamine 2000 (Invitrogen) following the manufacturer’s protocols (final concentration: 100 nM). At 48 hrs after transfection, cells were collected for measuring miR-7 expression or used for further experiments. For luciferase reporter assay, 3ʹ-UTR fragment of MRP1 and BCL2 was cloned into the pGL3-control vectors (Promega). The mutant construct was developed by using the Phusion Site-Directed Mutagenesis Kit (ThermoFisher Scientific). HEK293 cells were seeded in 24-well plates and co-transfected firefly luciferase reporter vector, control Renilla pRL-TK vector (Promega) with control mimic, miR-7 mimic, control inhibitor, or miR-7 inhibitor using the Lipofectamine 2000. At 48 hrs after transfection, cells were lysed and the activity of firefly and Renilla luciferase was assessed using the Dual-luciferase Reporter Assay System (Promega) according to the manufacturer’s instructions. Each treatment was performed with 4 replicates, and firefly luciferase activity was normalized to Renilla luciferase activity for each well.
5
Modulating CDR1as and miR-7 in Drug-Resistant Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MCF‐7 cells with the maximum difference of CDR1as expression and MDA‐MB‐231 cells with the minimum difference of CDR1as expression when compared with that of MCF10A cells were selected for the following experiments. After inducing drug resistance, MCF‐7‐R cells and MDA‐MB‐231‐R cells were divided into the following groups: blank (no treatment), empty plasmid, si‐CDR1as (cells transfected with the siRNA plasmid for CDR1as), CDR1as (cells transfected with the overexpression plasmid for CDR1as), negative control (NC, cells transfected with a negative control sequence of miR‐7), miR‐7 mimic (cells transfected with the miR‐7 mimic), miR‐7 inhibitor (cells transfected with the miR‐7 inhibitor) and si‐CDR1as + miR‐7 mimic (cells cotransfected with the siRNA plasmid for CDR1as and the miR‐7 mimic). Empty plasmid, siRNA interference plasmid, overexpression plasmid, the negative control sequence of miR‐7, miR‐7 mimic and miR‐7 inhibitor were purchased from Shanghai GenePharma Co., Ltd. (Shanghai, China). The cells were transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. The cells in each group were cultured in an incubator for 48 hours for further experiments.
6
RNA Oligoribonucleotide Synthesis and Sequences
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA oligoribonucleotides used in this study, including miR-7 mimic, miR-7 inhibitor, the small interfering RNAs (siRNAs) targeting CDR1as (si-CDR1as) or GDF5 (si-GDF5), and the corresponding miRNA control (miR-NC) and siRNA control (si-NC), were purchased from GenePharma Co. (Shanghai, China). The sequences of these RNA oligoribonucleotides are listed in Additional file 1 (Table S1).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!