Total RNAs from mouse tissues were extracted using TRNzol according to the manufacturer's instructions. The first-strand DNA synthesis using total RNAs from mouse tissues as the templates was performed with 4 × EZscript Reverse Transcription Mix II. The standard material for calibration curves of coding sequence of mouse Thumpd2 (NM_028138.1) was constructed into plasmids pcDNA3.1(+)-Thumpd2. The copy number of standards could range from 101 to 1010, which based on the known concentrations of DNA standard molecules. RT-qPCR was performed using the standard curve method in QuantStudio 7 (Life Technology) with ChamQ Universal SYBR QPCR Master Mix as the dsDNA fluorescence dye. The amplification efficiency (E%) of standard material must be in the range of 90–110%. Thus, we designed several primers for each gene and pick up one that meets the amplification efficiency. The primers finally used for the Thumpd2 in the RT-qPCR are listed in Supplementary Table S1 .
Chamq universal sybr qpcr master mix
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ChamQ Universal SYBR qPCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) applications. It contains all the necessary components, including a DNA polymerase, SYBR Green I dye, and optimized buffer system, to perform reliable and sensitive qPCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (6 mentions)
Stepone plus equipment, by Thermo Fisher Scientific (3 mentions)
Quantstudio 7, by Thermo Fisher Scientific (2 mentions)
Hiscript 3 all in one rt supermix perfect, by Vazyme (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Steponeplus, by Thermo Fisher Scientific (2 mentions)
Abi 7300 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Quantstudio 5 real time pcr system, by Thermo Fisher Scientific (2 mentions)
1st strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Gdna wiper mix, by Vazyme (2 mentions)
Hiscript 3 qrt supermix, by Vazyme (2 mentions)
Sybr green rt pcr master mix, by Thermo Fisher Scientific (2 mentions)
Hifair 3 first strand cdna system, by Yeasen (2 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (1 mentions)
Abi 7500, by Thermo Fisher Scientific (1 mentions)
Step one plus system, by Roche (1 mentions)
Reverse transcription kit, by Takara Bio (1 mentions)
Quantstudio 5 system, by Thermo Fisher Scientific (1 mentions)
Tianamp genomic dna kit, by Tiangen Biotech (1 mentions)
29 protocols using chamq universal sybr qpcr master mix
1
Quantitative Real-Time PCR for Gene Expression
2
Quantitative RT-PCR of Mouse Thumpd3 and Trmt112
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs from mouse tissues were extracted using TRNzol Universal Reagent according to the manufacturer's instructions. The first-strand DNA synthesis using total RNAs from mouse tissues as the templates was performed with HiScript III RT SuperMix for QPCR (+gDNA wiper). The standard material for calibration curves of coding sequence of mouse Thumpd3 and Trmt112 were constructed into plasmids pMD™18-T-THUMPD3 and pcDNA3.1(+)-TRMT112, respectively. The copy number of standards could range from 101 to 1010, which based on the known concentrations of DNA standard molecules. qRT-PCR was performed using the standard curve method in QuantStudio 7 (Life Technology) with ChamQ Universal SYBR QPCR Master Mix as the dsDNA fluorescence dye. The reactions were performed under the following conditions: 95°C for 2 min; 40 cycles of 95°C for 10 s, 55°C for 30 s, 72°C for 30 s. The amplification efficiency (E%) of standard material must in the range of 90–110%. Thus, we designed several primers for each gene and pick up the one that meets the amplification efficiency. The primers finally used for the Thumpd3 and Trmt112 in the qRT-PCR are listed as follow.
Mouse- Thumpd3-primer forward:
GCCTGGGTATGAACCTTGATG
Mouse- Thumpd3-primer reverse:
GCCAGACTTTCCACTGCAATATC
Mouse- Trmt112-primer forward:
GAGCACGACGAGACATTTTTGA
Mouse- Trmt112-primer reverse:
GGTGCCCTCCAGTACATCA
Mouse- Thumpd3-primer forward:
GCCTGGGTATGAACCTTGATG
Mouse- Thumpd3-primer reverse:
GCCAGACTTTCCACTGCAATATC
Mouse- Trmt112-primer forward:
GAGCACGACGAGACATTTTTGA
Mouse- Trmt112-primer reverse:
GGTGCCCTCCAGTACATCA
3
Quantitative Analysis of Hepatic Lipid Metabolism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by homogenizing the liver in RNA-easy Isolation Reagent following the manufacturer’s instructions and was quantified by Nanodrop (Thermo Fisher Scientific, Inc., Wilmington, DE, USA). Reverse transcription was performed using the HiScript® III RT SuperMix. And qRT-PCR was performed using ChamQ Universal SYBR® qPCR Master Mix on the StepOne Plus (Thermo Fisher Scientific, USA) following the manufacturer’s protocol. The list of primers (Sangon Biotech, Shanghai, China) used for real-time PCR analysis is described in Table 1 . Levels of PPARa, ACS, and CPT1a mRNA were subsequently normalized to GAPDH mRNA levels, the calculation method was 2−△△CT.
Primers of gene for qRT-PCR.
| Gene | Primer sequence | Product size (bp) | |
|---|---|---|---|
| GADPH | Forward | AGGAGCGAGACCCCACTAACA | 247 |
| Reverse | AGGGGGGCTAAGCAGTTGGT | ||
| PPARα | Forward | GAGCTGCAAGATTCAGAAGAAG | 171 |
| Reverse | GAATCTTTCAGGTCGTGTTCAC | ||
| ACS | Forward | ATGTACGATGGCTTCCAGAGGG | 254 |
| Reverse | GGGACGACCACCATTGAGTAAGA | ||
| CPT1a | Forward | TCAAGAATGGCATCATCACTGG | 177 |
| Reverse | CGATGTTCTTCGTCTGGCTTG |
4
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol reagent. cDNA synthesis of genes involved using PrimeScript RT Master Mix. Semi-PCR and real-time qPCR involved use of ChamQ Universal SYBR qPCR Master Mix with the StepOne Real-Time PCR System (Thermo Fisher Scientific, MA, USA). Experiments were carried out according to the manufacturer’s instructions. Data were acquired with QuantStudio 6 Flex Software v 1.3. Products of semi-PCR were separated by agarose gel electrophoresis. The fold change in the gene expression was calculated using the comparative Ct method, and two or three replicates were tested for each cDNA sample. ACTB or Actb were used as an internal reference. The sequences of the primers are listed in Supplementary Data 6 .
5
Quantifying miRNA Expression in Rat Skeletal Muscle
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of rat skeletal muscle (60–80 mg) was obtained using an extraction kit (cat. no. R401-01), and cDNA was created by the HiScript II 1st Strand cDNA Synthesis Kit (cat. No. R211-02). In a thermal cycler (ABI 7500, Thermo Fisher Scientific, Inc., Shanghai, China), quantitative real-time polymerase chain reaction (qPCR) was conducted using a ChamQ Universal SYBR qPCR Master Mix (cat. No. Q711-02,). The reagents used above were obtained from the China Vazyme Biotech Co., Ltd. (Nanjing, China) Each sample’s level of U6 expression was evaluated to normalize gene expression for variations in RNA input, RNA quality, and reverse transcription efficiency, and the 2−ΔΔCt relative quantification technique was used to quantify the fold differences in miRNA expression levels across samples. The primer sequences (SunYa Biotechnology Co., Ltd., Zhejiang, China) were as follows (forward and reverse, 5'-3'): U6, CTCGCTTCGGCAGCACATATACT (forward) and ACGCTTCACGAATTTGCGTGTC (reverse); miR-146a-5p, CCGCGCTGAGAACTGAATTCCA (forward) and AGTGCAGGGTCCGAGGTATT (reverse) and GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCCA (RT).
6
Quantitative RT-PCR of Total RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from cell lysates using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. The HiScript™ II QRT SuperMix was used to reverse total RNA (1 μg) into cDNA synthesis following the manufacturer’s instructions. Amplification was performed using qRT-PCR using a Step One Plus system (Roche Molecular Diagnostics, Pleasanton, CA, USA) in 20 μl of reaction mixture including 2 μl of cDNA template, 4 μl of each primer in double-distilled H2O, and 10 μl of ChamQ™ Universal SYBR qPCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA). The PCR conditions were as follows: 30 cycles of denaturation at 95°C for 60 sec; annealing at 60°C for 60 sec; and PCR extension at 72°C for 1 min; and a final extension step at 72°C for 10 min. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was used as internal control. The 2−ΔΔCq method was used to calculate relative expression levels [21 (link)].
The PCR primer sequences used were:
The PCR primer sequences used were:
7
Quantitative Expression Analysis of Candidate Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from fresh M and F type flowers using a kit, according to the manufacturer’s instructions (Magen, Guangzhou, China). The concentration of the extracted total RNA was measured using the NanoDrop technique (Thermo Fisher Scientific, United States), the equivalent amount RNA was reverse transcribed into cDNA using a reverse transcription kit (TAKARA, Beijing, China). Six candidate genes were chosen to verify the RNA-seq data. Quantitative real-time PCR (qRT-PCR) was performed using an Applied Biosystems QuantStudio 5 system (Thermo Fisher Scientific, United States) with the ChamQ Universal SYBR qPCR Master Mix. The PCR reaction was performed as follows: pre-denaturation 95°C for 30 s, denaturation at 95°C for 30 s, annealing at 58°C for 30 s, this reaction was repeated for 40 cycles. Subsequently, an extra procedure was conducted as follows: denaturation at 95°C for 15 s, annealing at 60°C for 1 min, extension at 72°C for 15 s. The fluorescence signal was then detected, and the dissolution curve analyzed. The primer sequences of the candidate genes are listed in Table 1 . The relative expression patterns of the target genes were calculated using the 2−ΔΔCT method and repeated in triplicate (Livak and Schmittgen, 2001 (link)). The selected expression patterns were visualized using TBtools (Chen et al., 2020 (link)).
8
Quantitative Analysis of Periodontitis Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s instruction, total RNA was extracted using TRIzol Reagent (Invitrogen, CA, USA) from samples of the periodontitis patient and normal periodontium. It was then purified using 75% ethanol, isopropanol and RNase-free water. Using HiScript® III All-in-one RT SuperMix Perfect, cDNA was created following the measurement of the RNA concentration and purity (Vazyme Biotech Co., Ltd.). The QuantStudio 3 Real-Time PCR System from Thermo Fisher Scientific was used to perform RT-qPCR with the ChamQ Universal SYBR qPCR Master Mix. The 2-DDCT mode was used to quantify the expression level. The reference gene for quantitative analysis was GAPDH. In Supplementary Table 1
9
Detecting H. felis Colonization in Gastric Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To detect colonization of H. felis in gastric tissue, RT-qPCR was done to detect H. felis-16S expression in gastric tissue. The total DNA of gastric tissue was extracted with a TIANamp Genomic DNA kit according to the manufacturer (Tiangen Biotech, Beijing, China) instructions. Quantitation was done using the ChamQ™ Universal SYBR qPCR master mix (Thermo Fisher, Boston, MA, USA). Primers (forward and reverse, respectively) were designed by GENEWIZ based on the follows: GAGCTGAACGGGAAGCTCAC and AGTCTAGCCCAAGATGCCCT for GAPDH; TTCGATTGGTCCTACAGGCTCAGA and TTCTTGTTGATGACATTGACCAACGCA for H. felis-flaB. Analysis and fold-change were determined using the CT method.
10
Quantitative Analysis of Periodontitis Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s instruction, total RNA was extracted using TRIzol Reagent (Invitrogen, CA, USA) from samples of the periodontitis patient and normal periodontium. It was then purified using 75% ethanol, isopropanol and RNase-free water. Using HiScript® III All-in-one RT SuperMix Perfect, cDNA was created following the measurement of the RNA concentration and purity (Vazyme Biotech Co., Ltd.). The QuantStudio 3 Real-Time PCR System from Thermo Fisher Scientific was used to perform RT-qPCR with the ChamQ Universal SYBR qPCR Master Mix. The 2-DDCT mode was used to quantify the expression level. The reference gene for quantitative analysis was GAPDH. In Supplementary Table 1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!